GDV Proseminar “Visualisierung in der Bioinformatik” Genom – Visualisierung FfM., den 05.06.2003

  • View
    28

  • Download
    0

Embed Size (px)

DESCRIPTION

Johann Wolfgang Goethe-Universität Frankfurt am Main. GDV Proseminar “Visualisierung in der Bioinformatik” Genom – Visualisierung FfM., den 05.06.2003 Oleg Rempel und Sven Zöller. Gliederung. 1 Einleitung 1.1  Exkurs ins menschlichen Genom 1.2  Human Genom Projekt - PowerPoint PPT Presentation

Text of GDV Proseminar “Visualisierung in der Bioinformatik” Genom – Visualisierung FfM., den...

  • GDV ProseminarVisualisierung in der Bioinformatik

    Genom VisualisierungFfM., den 05.06.2003

    Oleg Rempel und Sven ZllerJohann Wolfgang Goethe-Universitt Frankfurt am Main

  • Gliederung1 Einleitung1.1 Exkurs ins menschlichen Genom1.2 Human Genom Projekt2 Graphisches Darstellen von Genomen2.1 Ziele2.2 Probleme3 ProtAnnot und Neomorphic GeneViewer3.1 Hintergrund3.2 Semantisches Zooming3.3 Zweidimensionales Zooming3.4 Einzelne oder doppelte Reihenfolge der Genstruktur3.5 Umgang mit der Komplexitt der Informationen3.6 Proteinvorhersage4 Beispiel SeqVISTA4.1 Hintergrund4.2 SeqVISTA4.3 repetitive Elemente4.4 Proteinstruktur5 ZusammenfassungProseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Genom als der Bauplan des Lebens1 Einleitung1.1 Exkurs ins menschliche Genom

    Genom (Erbgut) ist die Gesamtheit der Erbinformation einer Zelle.

    Die Erbinformation ist die in der DNA jeder Zelle gespeicherteInformation zur Ausbildung von Merkmalen. Unter Merkmalen versteht man die Entwicklung, das Aussehen, dasVerhalten, die Gesundheit und die Neigung zu bestimmtenKrankheiten.

    Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Sitz des Genoms1 Einleitung1.1 Exkurs ins menschliche Genom

    Jede Zelle des menschlichen Organismus besitzt das komplette Genom.

    Das meiste menschliche Genom (99,9995%) befindet sich im Zellkern.

    Rest (0,0005%) in Mitochondrien der Zelle.

    Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • DNA1 Einleitung1.1 Exkurs ins menschliche Genom

    Erbsubstanz der Erbinformation ist dieDNA (DesoxyriboNucleid Acid).

    Die DNA besteht aus Bausteinen(Nukleotiden), die in zwei komplementrangeordneten Strngen miteinanderVerknpft sind.

    Die beiden DNA-Strnge sind spiralfrmigum die eigene Achse gewunden, bilden sogenannte Doppelhelix.

    Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Von Doppelhelix zu einem Chromosom1 Einleitung1.1 Exkurs ins menschliche Genom

    Die Doppelhelix ist durch mehrfaches Umwickeln sehrdicht gepackt und bildet zusammen mit HistonProteineneine Chromatinfaser aus.

    Die Chromatinfaser ist ihrerseits umgewickelt undbildet Chromosomen aus.

    Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Chromosomen1 Einleitung1.1 Exkurs ins menschliche Genom

    Bei einem Mensch gib es 23Chromosomen, die normalerWeise doppelt vertreten sind.

    Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Chromosomen1 Einleitung1.1 Exkurs ins menschliche Genom

    Ein Chromosom ist ca. 1,4 mbreit und ist unter demMikroskop sichtbar.

    Ein Chromosom kann mehrereGene enthalten.

    Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Gen1 Einleitung1.1 Exkurs ins menschliche Genom

    Gen ist ein bestimmterproteinkodierender DNAAbschnitt.

    Im menschlichen Genom sindca. 27 000 30 000 Gene,davon sind in Mitochondrien13 Gene. Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Codierung1 Einleitung1.1 Exkurs ins menschliche Genom

    Es gibt 4 verschiedene Nukleotide in der DNA: A,C,G und T

    Da jedes Nukleotid immer einen spezifischen Partner in dem zweiten DNA-Strang hat, nennt man die beiden Partner ein Basenpaar.

    Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Codierung1 Einleitung1.1 Exkurs ins menschliche Genom

    Die Abfolge der Besenpaaren kann bei der Expression in die Abfolge derAminosuren eines Proteins bersetzt werden.

    Drei Basen eines DNA-Stranges sind die kleinste Informationseinheit derDNA und wird als Codon oder Basentriplett bezeichnet.

    Ein Codon kodiert eine bestimmte Aminosure oder hat eine andere Funktion.

    Es gibt 64 (43) mgliche Codons und nur 20 Aminosuren die sie kodieren.Das erschwert die Entzifferung der Codierung.

    Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Sequenz1 Einleitung1.1 Exkurs ins menschliche Genom

    Die Abfolge der Nukleotiden in der DNA bezeichnet man als Sequenz.

    Bei Menschen insgesamt: 3,2 Milliarden Besenpaaren, nur 1- 5% davon stellen Gene dar.

    In Mitochondrien: 16 kbp

    Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Sequenz -Regionen1 Einleitung1.1 Exkurs ins menschliche Genom

    Man unterscheidet verschiedene Regionen der Sequenz:Exon die proteinkodierende RegionIntron hat keine proteinkodierende Funktion.Promotor Region, wo die Transkription startet.Terminator Region, wo die Transkription endet.

    ORF offener Leseraster.URF nichtidentifizierter Leseraster Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Sequenz1 Einleitung1.1 Exkurs ins menschliche Genom

    >gi|16164037:211292-256037 Homo sapiens chromosome Y genomic contig

    GTTTGTGGCCTGGTCGGCGTCCCGTAGGGCGCCCTCCCGCGCTAGGCCGGCCGGCGTGGCGCTCGGCGCCGAACAGGCCCCGAGGAGGCCGCAGTTAGGCCTAGTGATTATCCAGTTGCCCTGAGCGGCTGCGGAGGTGCGCTCCATAAGCGGGCAGGGTGGGAAAAGTTCGCCCGTTTGTCCGGAAGGCAGTTGATGGACCTGGGGTCGACACCACTGCGGACGCAGGGCACGGCACGGGGGCGAGAAGGCGAAGGCTGCAGGCGTGAGGTGAAGGCCGGAGGCCTGCTGGGCCTATTTTCGCTATGTAAATGTCCGCGAAGGGGAGGAGGGACGGGGGGGCAAGATGGCGGCTGCTAGGCGCCTGCTGCTGGGGAGTATTGAGAGTGTTGTCGGGAGGCGGAGCCGCCATCTTGAAGGCGGTATCTGGAAAAAAAATTCGGTTATGATCCTTGAGGCGGGGATGGGGAAAAGGACGGCGGCGGCGGCGGCAGCGCAGCCTCCGGCGCGACGGCGTGTCTGCGCAACAGGGCGTGCTCGTTCCCTTGGCGGCCCTTGCCTTTGTCGCCATATGCGCGCGTACGTTCCAGACGCCTGCGGCAGCGCCACCTTTCGGCCTTCCCCTCACAGCCCATCCTTGGCTGGGTGCAGTGTCGGCTACGCTTTAGGTGACATGCCGCAGGCGTCCGTTCGGGCGCCGGGGTCATTTCGCCCCTCAGCGCTCCCGGCTCTGTGCCCTTCCGAGAGTCTACAGCCACCCGTTTCAGCAGGTGGCAATTCGGGCATCTAGGCTCACGAGAGCACATAAATTCCAGAAAATTTTATTTTCCCCTAATTAAAGTCATTATGTGGCTGTTCGGGGACCTTCGATGCGCTTATTTTTCAACCATCProseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Daten 1 Einleitung1.2 Human Genom Projekt

    1986 Aufruf des amerikanischen Krebsforschers Renato Dulbecco das komplette menschliche Genom zu entschlsseln.1987 Amerikanische Kongress bewilligt 200 Millionen Dollar jhrlich,geplant sind 15 Jahre arbeit.1997 Start des Human Genom Projektes in Deutschland.2000 Erste Ergebnisse wrden verffentlicht.2001 Begann die zweite Phase des Projektes.

    Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Ziel1 Einleitung1.2 Human Genom Projekt

    Das Ziel des ffentlich finanzierten Humangenomprojektes ist, aller Wissenschaftler mit einem ffentlichem Verzeichnis der Gensequenzzu versorgen, und dadurch die biomedizinische Forschung zubeschleunigen.

    Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Firmen 1 Einleitung1.2 Human Genom Projekt

    Im Jahre1991 wird HUGO (HUman Genom Organisation) gegrndet, welchedie Durchfhrung des Projektes koordinieren soll.

    Wenig spter hat aber eine private US-Firma "Celera Genomics" desGenforschers Craig Venter die Fhrung bernommen.

    Die deutschen Firmen erhoffen bei der zweiten Phase des Projektes, wo eshauptschlich um die Erkennung der Genfunktionen geht, die Nase vorne zuhalten.

    Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Ergebnisse 1 Einleitung1.2 Human Genom Projekt

    Obwohl in der Presse schon mehrmals verkndet wurde, dass das menschlicheGenom beinah vollstndig entziffert ist und verffentlicht wurde,Wissenschaftler in der ganzen Welt arbeiten noch heftig daran.

    Hauptgrunde dafr sind:Die Funktion der meisten Genen ist noch unbekannt.Viele Gene besitzen mehrere Funktionen.Die entzifferten Gensequenz kann Fehler enthalten.

    Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Die Bereitstellung der Sequenz2 Ziele und Probleme beim graphischen Darstellen von Genomen 2.1 Ziele

    Wie in Humangenomprojekt ist auch hier das Hauptziel, aller Wissenschaftler mitder ffentlichen Gensequenz zu versorgen.

    Die entzifferten Daten sind da, aber die sind oft viel zu unbersichtig undkomplex, deshalb werden effektive Visualisierungswerkzeuge gebraucht,welche die Wissenschaftler helfen damit zu arbeiten.

    Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Grafische Darstellung2 Ziele und Probleme beim graphischen Darstellen von Genomen 2.1 Probleme

    Ein ntzlicher und effektiver Weg etwas unbersichtliches sichtbar zu machen ist die grafische Darstellung.

    Providerswerkzeuge:

    Das LocusLink von NCBI und der Genomsuch-Browser von UCSC.

    Beide arbeiten aber in sogenannten Client-server modelProseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Java-Applets 2 Ziele und Probleme beim graphischen Darstellen von Genomen 2.1 Probleme

    Das Client-server model erschwert viele Manipulationen.

    Es wird versucht das Problem durch Java-Applets zu lsen, die von dem Serverruntergeladen werden knnen und in einer Java vitrual machine auf dem PC desBenutzers laufen und verndern werden knnen.

    Aus Sicherheitsgrnden sind die Java-Applets aber etwas problematisch,da die sehr wohl Trojaner seien knnen.

    Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • ProtAnnot und Neomorphic GeneViewer 3 ProtAnnot und Neomorphic GeneViewer3.1 Hintergrund

    Als Beispiele der alternativen Visualisierungstechnik werden hier als erstes ein Prototyp des Protein-Domain-Viewer ProtAnnotund Neomorphic GeneViewer, ein Genombrowser,der zuerst fr das Institut der Genomforschung (TIGR)speziell fr das Arabidopsis Genom geschrieben wurde.

    Proseminar Visualisierung in der BioinformatikGenom Visualisierung

  • Semantisches Zooming 3 ProtAnnot und Neomorphic GeneViewer3.2 Semantisches Zooming

    Proseminar Visualisierung in der BioinformatikGenom