Cell Reports, Volume 18

Supplemental Information

Sirt1 Regulates DNA Methylation

and Differentiation Potential of Embryonic

Stem Cells by Antagonizing Dnmt3l

Jinbeom Heo, Jisun Lim, Seungun Lee, Jaeho Jeong, Hyunsook Kang, YongHwanKim, Jeong Wook Kang, Hwan Yeul Yu, Eui Man Jeong, Kyunggon Kim, MagdaKucia, Sabine J. Waigel, Wolfgang Zacharias, Yinlu Chen, In-Gyu Kim, Mariusz Z.Ratajczak, and Dong-Myung Shin

Figure S1. Transcriptome analysis of Sirt1-/- ESCs, Related to Figure 1 (A) Heat map analysis illustrates microarray results with hierarchical clustering of imprinted genes (Table S1). (B) The 10 most highly represented biofunctions are shown for the Sirt1-/- vs. Sirt1+/+ ESC transcriptome comparison. The graphs are ordered by experimental p values. (C) Gene get enrichment analysis results and enrichment plots of imprinted (n = 89) and germline developmental (n= 398) genes (Table S1) in comparison of Sirt1-/- vs. Sirt1+/+ cells. ES, enrichment score; NES, normalized enrichment score; NOM p-val, nominal p value; FDR, false discovery rate. (D) A represented gene network analysis is shown for Ndn, an imprinted gene identified in Sirt1-/- vs. Sirt1+/+ ESCs. Gene networks are illustrated by overlaying experimental values as fold changes for the Sirt1-/- vs Sirt1+/+ comparison. Up- and downregulated genes shown in the heat map (A) and gene network (D) analyses are indicated in red and green, respectively. (E-H) RQ-PCR analysis was performed for imprinted and germline developmental genes in Sirt1-/- ESCs, which were established by two different strategies homologous recombination (E and H) and CRISPR-Cas9 system (G), as well as in Sirt1 cDNA-rescued cells (CDS-Res) cultured with a MEF feeder (H). Knock-out of the Sirt1 protein by the CRISPR-Cas9 system was validated by western blot (W.B.) in five independent Sirt1 deficient clones (KO_C8, C10, C11, C16, and C18) and two wild-type clones (WT_C4 and C6) (F). Data were calculated as the ratio of the value of Sirt1-

/- to Sirt1+/+ ESCs (set to 1; red dotted line) and are shown as means ± SEM (n =4). *p < 0.05, **p < 0.01, ***p < 0.001, ns: non-significant (one- or two-way ANOVA with Bonferroni post-hoc tests). Blue lines indicate half of the expression level of Sirt1+/+ ESCs.

Figure S2. Abnormal DNA methylation status in Sirt1-/- ESCs, Related to Figure 2 (A and B) Representative examples are shown for the methylation statuses of imprinted (A, H19-Igf2, Snrpn, and Ndn loci) and germline developmental (B, Stra8 and Pla2g1b) genes. Exons are shown in boxes. Methylation levels are shown as fold changes in the value of Sirt1-/- to Sirt1+/+ ESCs by the chromosome browsers. Up- and downregulated peaks in Sirt1-/- ESCs are indicated in red and blue, respectively. (C) Biofunction analysis was performed on genes that showed increased DNA methylation following Sirt1 deficiency (see Table S2 for gene list). Biofunctions enriched by gene ontology (GO) processes are ordered according to experimental p values. (D) qChIP analysis for 5-hydroxymethyl cytosine (5hmC) in Sirt1+/+ and Srit1-/- ESCs. Enrichment of 5hmC was calculated as the ratio of the value of the bound fraction (B) to that of the unbound fraction (UB). The fold difference is represented by the ratio to Sirt1+/+ ESCs (set to 1) and is displayed as means ± SEM (n = 4) (*p < 0.05, ***p < 0.001, two-way ANOVA). (E) COBRA assay was performed on the affected imprinted genes in the indicated ESCs cultured with 2i-LIF medium. According to COBRA, unmethylated (Un) DNA was not cleaved, in contrast to methylated (M) DNA, because of sequence changes at the site recognized by the BstUI restriction enzyme after the bisulfite reaction. (F) BSS of the affected imprinted and germline developmental genes is shown for the indicated cells. The numbers under each BSS profile indicate the percentage of methylated CpG sites (means ± SEM, n = 3, *p < 0.05, **p < 0.01, compared with Sirt1+/+ ESCs, one-way ANOVA with Bonferroni post-hoc tests). Methylated and unmethylated CpG sites in bisulfite sequences are shown as filled and open circles, respectively. DMR, differentially methylated region; IG-DMR, intergenic-DMR; KvDMR, DMR of Kcnq1 locus; CDS-Res, Sirt1 cDNA-rescued cells.

Figure S3. DNA methylation is responsible for the repression of imprinted and germline genes in Sirt1-/- ESCs, Related to Figure 3 (A and B) COBRA analysis (A) was performed on the imprinted genes and BSS (B) was performed for germline developmental genes in Sirt1-/- ESCs after treatment with the indicated doses of 5-azacytidine (5-Aza) for 2 days. nc, negative control for PCR. The numbers under each BSS profile indicate the percentage of methylated CpG sites (means ± SEM, n = 3, **p < 0.01, one-way ANOVA). (C) RQ-PCR was performed for Sirt1-targeted imprinted and germline developmental genes in the absence or presence of the indicated dose of valproic acid (VPA) for 2 days. Data are represented as the ratio to Sirt1+/+ ESCs (set to 1; red dotted line) and are shown as means ± SEM (n = 3). *p < 0.05, **p < 0.01, two-way ANOVA with Bonferroni post-hoc tests. Blue lines indicate half of the expression level of Sirt1+/+ ESCs. (D) Western blot (W.B.) was used to confirm the silencing of Dnmt proteins in Sirt1-/- ESCs that stably express shRNAs against the indicated Dnmt3 family genes. Molecular weight (M.W.) marker sizes (kD) are shown on the left. (E and F) RQ-PCR was used to analyze Sirt1-targeted genes in Dnmt3a or Dnmt3b knockdown (D, n = 4) as well as Dnmt3a and Dnmt3b double knockdown (DKD) Sirt1-/- ESCs (F, n = 4). (G-I) Expression levels for the TET proteins (G) and transcripts (H, n = 4) as well as 5-hydroxymethyl cytosine (5hmC, I) in the indicated cells. RQ-PCR data is shown as mean ± SEM. -actin was used as a loading control. (*) indicates a nonspecific band, W.B. stands for western blot. (J) RQ-PCR results are shown for CRISPR-Cas9 Dnmt3l-deficient cells (n = 3). Data are represented as the ratio to Sirt1+/+ ESCs and are shown as means ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, two-way ANOVA. (K) Knock-out of Dnmt3l by CRISPR-Cas9 was validated by western blot.

Figure S4. The interaction between Sirt1 and Dnmt3l proteins, Related to Figure 5 (A) Immunoprecipitation (IP) analysis was performed in 293FT cell extracts that were cotransfected with Flag-tagged Sirt1 and the indicated Dnmt-expressing plasmids. An empty plasmid (Flag) was used instead of Flag-tagged Sirt1 as the control. (B) GST pull-down (PD) analysis was performed using in vitro translated Flag-tagged Sirt1 and GST-fused Dnmt3l fragment proteins. (C) HA-tagged Dnmt3 proteins were immunoprecipitated (IP) using an HA antibody from Sirt1+/+ ESC whole cell extracts 24 hours after transfection of the indicated HA-tagged protein-expressing plasmids. Acetylated proteins in the IP products were detected by western blot (W.B.) with antibodies specific to acetylated lysine (Ac-K). (D and E) IP was performed on acetylated proteins in the nuclear extracts (E) and mass spectrometry (D) identified the upper band at around 50 kD molecular weight (asterisk in E) as the p53 protein. (F) Acetylated lysine residues (K) were identified by mass spectrometry analysis of HA-immunoprecipitated materials in HA-tagged Dnmt3l expressing Sirt1-/- ESCs. The acetylation sites (K57, K214, K238, K255, K395, and K412) are indicated in the schematic diagram of mouse Dnmt3l (total length: 421 amino acids), PHD; plant homeodomain-like domain, I, IV, VI, IX; conserved cytosine methyltransferase motifs. The representative spectrum for acetylated peptide and corresponding peptide sequence were shown below Dnmt3l diagram. Red and blue lines in spectra indicate b ions and y ions, respectively and green lines mean precursor ions. Numbers in parenthesis show amino acid residue number.

Figure S5. The transcription activity of Dnmt in CHX-chase assays, Related to Figure 5 (A and B) The change in transcript levels for Dnmt and Sirt1 are shown during treatment of (A, see Figure 5E) nicotinamide (NAM) or (B, see Figure 5G) cycloheximide (CHX)-chase in the absence or presence (D) of 5-g/ml actinomycin D (ActD). Expression levels are represented as the ratio to non-treated Sirt1+/+ ESCs and are shown as means ± SEM (n = 4). *p < 0.05, **p < 0.01, ***p < 0.001, one- or two-way ANOVA with Bonferroni post-hoc tests. (C and E) Stability of the Dnmt3l proteins in Sirt1+/+ and Sirt1-/- ESCs was measured using a cycloheximide (CHX)-chase assay following inhibition of de novo transcription (C) or ectopic expression of HA-tagged Dnmt3l proteins (E). Dnmt3l protein expression (C, right panel) was normalized to that of -actin. Data are shown as means ± SEM (n = 3). **p < 0.01, ***p < 0.001 compared with Sirt1+/+ ESCs, two-way ANOVA.

Figure S6. In vitro and in vivo differentiation defects in Sirt1-/- ESCs, Related to Figure 6 (A) Western blot analysis (W.B.) was performed for germline gene products on the indicated day of Sirt1+/+ and Srit1-/- EB. (B) COBRA assay was performed on the retinoic-acid (RA) signaling targeted genes in Sirt1+/+ and Srit1-/- ESCs. The Meg3 locus was used as positive control. (C) RQ-PCR was performed for the RA signaling targeted genes after the RA (0.2 M) treatment days. Data are represented as the ratio to Sirt1+/+ ESCs before RA treatment (n = 4). (D) Expression of neuronal markers is shown for differentiated cells from the indicated ESCs. Data are represented as the ratio to Sirt1+/+ cells (set to 1; red dotted line, n 4). Blue lines indicate half of the expression of Sirt1+/+ ESCs. (E) Histological analysis of hematoxylin and eosin-stained teratoma sections demonstrate differentiation of the three germ layers from the indicated ESCs. (F) RQ-PCR analysis was performed for the germline developmental genes in EBs on the indicated day (n = 4). Expression levels are represented as the ratio to 0 day-old Sirt1+/+ EBs (n = 4). All RQ-PCR data are shown as means ± SEM. *p < 0.05, ***p < 0.001, compared with Sirt1+/+ cells, two-way ANOVA with Bonferroni post-hoc tests. CDS-Res: Sirt1 cDNA-rescued, 3L-KD: Dnmt3l-knockdowned.

Figure S7. Enriched undifferentiated cells during germline differentiation of Sirt1-/- ESCs, Related to Figure 7 (A) FACS analysis is shown for EMA-1+ cells from EBs on the indicated days. The percentage of EMA-1+ cells (arrowed line) is shown on the right side of the FACS histogram (means ± SEM, n = 10, *p < 0.05, **p < 0.01, ***p < 0.001 compared with Sirt1+/+ ESCs, two-way ANOVA with Bonferroni post-hoc tests). IgG isotype control (filled gray). CDS-Res, Sirt1 cDNA-rescued, 3L-KD: Dnmt3l-knockdown, EMA-1: epithelial membrane antigen-1. (B) Alkaline phosphate (AP) staining was performed on primordial germ cell (PGC) colonies formed by culturing MACS-isolated SSEA-1+ cells from the indicated 7 day-old EBs (left panel). The diameters (M) of the AP+ PGC colonies were calculated using the GelCount colony counter at the default setting (right panel). (C) RQ-PCR analysis was performed for pluripotency (Oct4) or early- (e.g. Blimp1 and Prdm14) and late- (Sycp3 and Sox17) PGC markers in the MACS-sorted SSEA-1+ cells from EBs on the indicated day. Expression levels are represented as the ratio to 0-day-old Sirt1+/+ EBs (means ± SEM, n = 3, *p < 0.05, **p < 0.01, ***p < 0.001, two-way ANOVA). (D and F) FACS analysis and FACS sorting of FE-J1-stained cells in adult mouse testes (D) or the 7-day-old Sirt1+/+ EBs (F) was performed. DAPI was used to determine the DNA content (right panel). 1C, haploid; 2C, diploid; 4C, G2/M phase. (E and G) COBRA assay was performed in paternally (Pat) methylated (H19 and Meg3) or maternally (Mat) methylated (Snrpn) DMRs in FE-J1+ cells that were FACS sorted from the adult mouse testes (E) or 20-day-old Sirt1+/+ EBs (G). The input shows whole cells from each sample. Un, unmethylated; M, methylated DNA.

Supplemental Experimental Procedures Cell culture

Murine R1 ESCs (Sirt1+/+ and Sirt1-/-, both were provided by Dr. Hal E. Broxmeyer, Indiana University School of Medicine) and ES-E14TG2a (purchased from ATCC, Manassas, VA) were grown in DMEM-high glucose medium (HyClone, Pittsburgh, PA) supplemented with 2 mM L-glutamine, 20 mM HEPES, MEM nonessential amino acid solution, penicillin/streptomycin solution (Corning Cellgro, Pittsburgh, PA), 0.1 mM -mercaptoethanol (Sigma-Aldrich, St Louis, MO), 15% heat-inactivated FBS (HyClone), and 100 IU/ml ESGRO/LIF (Millipore, Billerica, MA) on a 0.1% gelatin (Sigma-Aldrich) coated tissue culture dish or under the -irradiated mouse embryonic fibroblast (MEF) feeder. The MEF from C57BL/6 mice were prepared from E13.5 embryos, as previously described (Conner, 2001), and cultured in DMEM-high glucose medium supplemented with 2 mM L-glutamine, 20 mM HEPES, MEM nonessential amino-acid, and penicillin/streptomycin solution. MEF feeder cells were prepared using 4000 rads -irradiation, as previously described(Conner, 2001). To maintain ESCs ground state, they were maintained with 2i-LIF medium, ESGRO-2i Supplement Kit (Millipore) on a 0.1% gelatin coated tissue culture dish. To inhibit DNA methylation, ESCs were treated from 0.5–2 M 5-azacytidine (5-Aza) (Sigma-Aldrich) for 2 days before analyzing gene expression. Protein deacetylation was inhibited by supplementation with ESC medium and 2.5–20 mM nicotinamide (NAM) (Sigma-Aldrich) or 0.5–1 mM valproic acid (Sigma-Aldrich). For the cycloheximide (CHX)-chase assay, cells were treated with 100 g/mL CHX (Sigma-Aldrich) for the indicated hours in the absence or presence of 5 g/ml actinomycin D (Sigma-Aldrich) and western blot analysis was performed. Embryoid body (EB) formation

ESCs used in differentiation were maintained with 2i-LIF medium. For the differentiation assay, EB spheres were formed using the hanging drop method using Petri dishes, as previously described (Keller, 1995), at 2000 cells/drop. After 2 days, the formed EBs were freshly supplemented with EB formation medium (ESC medium without ESGRO/LIF) and further cultivated for the indicated days with additional media supplementation every 2 days. In vitro neuronal differentiation In vitro neuronal differentiation was performed using a 4-/4+ differentiation protocol developed by Gottlieb et. Al (Bain et al., 1995) with slight modifications. Briefly, 4-day-old EB spheres under EB forming medium (4- stage) were freshly replaced by neural inducer medium containing 0.5 mM all-trans retinoic acid (RA) (Sigma-Aldrich) and further cultivation for 4 days (4+ stage) with media replacement every 2 days. Five EBs were plated into to each well of a 50 g/ml poly-L-ornithine (Millipore) and 5 g/ml laminin (Millipore) coated 24-well chamber slide, and then maintained for 8 days with exchange the medium with fresh EB formation medium every two days. Neuronal like cells and their processes were stained with mouse anti-III-tubulin antibody (Millipore) with counterstaining of the nuclei with 4’,6-diamino-2-phenylindole (DAPI). The neuronal differentiation potency was quantified as III-tubulin+ cell/DAPI+ cells in 24 randomly chosen representative areas from each slide. In vitro germline differentiation

In vitro germ cell differentiation was performed as previously reported with slight modifications. Briefly, 7-day-old EB spheres were dissociated using StemPro Accutase (Life Technologies, La Jolla, CA) for 10 minutes at room temperature and resuspended in ESC medium without ESGRO/LIF. SSEA-1-expressing cells were isolated by magnetic activated cell sorting (MACS) using biotinylated SSEA-1 antibody (clone MC-480; BioLegend, San Diego, CA) and streptavidin-coupled Dynabeads (Invitrogen). The MACS-sorted SSEA-1+ cells were plated on MEF feeder cells on 24-well plates under ESC medium without ESGRO/LIF, but supplemented with 4 M RA (Sigma-Aldrich) and cultivated for 5 days with media replacement every 2 days. Thereafter, germ cells were detected using the alkaline phosphatase (AP) detection kit (Millipore), in accordance with the manufacturer's instructions, or immunostained with antibodies specific to the epithelial membrane antigen-1 (EMA-1) germ cell surface marker (DSHB, Iowa City, IA) (Hahnel and Eddy, 1986). The frequency and size distribution of the AP-stained germ cell colonies were analyzed using the GelCount colony counter (Oxford Optronix, Sanborn, NY) at its default settings. Transcriptome microarray hybridization and data processing

One hundred ng of total RNA was isolated from Sirt1+/+ or Sirt1-/- ESCs and converted to cDNA, which was followed by biotin labeling using the GeneChip 3’ in vitro transcription (IVT) kit (Affymetrix, Santa Clara, CA). The biotin-labeled aRNA was fragmented and hybridized to the GeneChip 3’ Mouse Genome 430

2.0 array (Affymetrix), in accordance with the manufacturer’s instructions. Microarray image data were processed using the GeneChip Scanner 3000 7G (Affymetrix) and GeneChip Command Console 1.0 (Affymetrix). The CEL files of 6 samples (3 samples for each genotyped ESC) were imported into Partek software version 6.5 (Partek Inc, Saint Louis, MO) and normalized using Robust Multi-Array (RMA) normalization. One-way ANOVA was used to assess difference in Sirt1+/+ vs Sirt1-/- ESC. Gene expression profile analysis

Heat maps with hierarchical clustering of the transcriptome microarray data from Sirt1+/+ or Sirt1-/- ESCs were prepared using Partek software and hierarchical agglomerative clustering with the Pearson Dissimilarity algorithm. Heat maps for the imprinted genes (98 genes and 225 probes) and germ cell development gene lists (440 genes and 881 probes) were individually developed (Table S1). Functional analysis of the transcriptomes and core analyses of the gene networks, biofunctions, and canonical pathways was performed using IPA software version 8.7 (Ingenuity Systems, Inc. Redwood, CA). For general global transcriptome comparisons between Sirt1+/+ and Sirt1-/- ESCs (Figure 1), the p-value cut-off was 0.00166404 (FDR = 0.001) and the expression cut-off value was set to 2-fold up- or downregulation (512 genes were eligible for data analysis). The minimum resolution for multiple probes was set at the experimental p value. Red and green represented up- and downregulated values, respectively. Biofunction and canonical pathway analysis of the indicated gene lists was performed using the default settings and a threshold value of 0.05, and Fisher’s Exact Test was used as the scoring method. Gene network analysis of all 98 imprinted genes was performed, and the Sirt1 putative targets were initially selected if they demonstrated 2-fold change in expression or their network included 2 interacting genes with 2-fold change in expression (Figure S1D). DNA methylome analysis

The DNA methylome of Sirt1+/+ and Sirt1-/- ESCs was analyzed using the Methylated CpG Island Recovery Assay (MIRA) (Mitchell et al., 2011), followed by the NimbleGen Mouse DNA Methylation 3x720K CpG Island Plus RefSeq Promoter tiling Array (NimbleGen, Indianapolis, IN). CpG methylated DNA was enriched using the MethylCollector Ultra Kit (Active Motif, Carlsbad, CA) using 1 g of genomic DNA that was fragmented using the Mse I restriction enzyme (New England BioLabs Inc, Ipswich, MA). The recovered methylated DNA was amplified using two-round primer extension, followed by PCR amplification of the primed DNA as previously reported(Adli et al., 2010). The amplified MIRA product was purified using the MinElute cleanup kit (QIAGEN, Valencia, CA). The MIRA products and corresponding input samples were labeled using the NimbleGen Dual-Color DNA labeling kits, then hybridized according to the manufacturer’s instructions.

Two-color NimbleGen arrays were scanned using the MS2000 Microarray Scanner, which generated both Cy3 (532) and Cy5 (635) image files. Each paired image file was imported to NimbleScan Software (v2.6) (NimbleGen). Using this software, the two image files were combined into 3 paired single-image files, which included 3 green (532) and 3 red (635) image files. The 3 paired-image files were further analyzed using the same software, and log2 ratio (Cy5/Cy3) data were generated and reported as GFF files (.gff). The pair files for 6 samples (3 samples for each genotyped ESC) were imported into Partek software, and the ratio of the signals was calculated and normalized using the Loess method. One-way ANOVA was set up for the different cell types with contrasts to compare Sirt1+/+ vs Sirt1-/- ESCs. The MAT algorithm was used to detect regions with statically significant DNA methylation peaks using the default cut-off settings (p value threshold = 0.05; average ChIP fragment length = 300bp, minimum number of probes in a region = 3; fraction of the highest and lowest probes excluded from calculation mean = 0.01) (Johnson et al., 2006) and then aligned in the Genome Browser provided by Partek software using MM9 murine genome annotation and presented as the fold change of Sirt1-/- relative to Sirt1+/+ ESCs. Gene ontology analysis of the highly methylated loci in Sirt1-/- ESCs

Genes located within 5 kb upstream and downstream of the DNA methylation peaks that were highly enriched in Sirt1-/- ESCs were listed using Partek software (Table S2). In total, 1327 RefSeq genes were selected using MAT score > 10 with p values < 0.005 cut-off and gene ontology analysis was performed using MetaCore microarray software (Thomson Reuters, New York, NY) with the default settings. DNA methylation analysis

The DNA methylation status of the individual loci were investigated using combined bisulfite-restriction analysis (COBRA) and bisulfite sequencing or quantified using quantitative realtime PCR (RQ-PCR) of MIRA pull-downed methylated DNA using the PikoReal System (Thermo Fisher Scientific, Pittsburgh, PA) with iQ SYBR Green PCR Master Mix (Bio Rad, Hercules, CA). DNA marked with 5-hydroxymethyl cytosine (5hmC) DNA was enriched using the antibody specific to 5hmC (Active Motif) using 1 g of genomic DNA

that was fragmented using the Mse I restriction enzyme (New England BioLabs Inc). All the primers used in the DNA methylation assay are available on request. Chromatin-immunoprecipitation (ChIP) assay

ChIP analysis was performed using a Magna ChIP G kit (Millipore, Billerica, MA) according to the manufacturer’s instructions. Cross-linked chromatin isolated from cell extracts (from 1 × 107cells) were sheared by sonication at 40% amplitude (four 15-second pulses in between 1-minute rest intervals on ice) in 500 L Nuclear Lysis Buffer, then immunoprecipitated using Protein G magnetic beads, conjugated with 3 g ChIP grade antibodies against Sirt1 (Epigentek Group Inc., Farmingdale, NY), Dnmt3l (Cell Signaling Technology, Danvers, MA), H4Ac (Millipore), H1K26Ac, Flag epitope, rabbit, or mouse immunoglobulin (Ig)G control antibodies (Sigma-Aldrich). The enrichment of each histone modification was calculated as the ratio of bound (B) to unbound (UB) amplicon fractions and represented as the mean ± SEM of ≥ 4 independent experiments. All primers used in the ChIP assay are available upon request. RQ-PCR for gene expression analysis

Quantitative assessment of the mRNA levels of the target genes was performed as described previously (Shin et al., 2012). Total RNA (50 ng) was reverse-transcribed using Taqman Reverse Transcription Reagents (Applied Biosystems, Foster City, CA), and the threshold cycle (Ct) was subsequently determined using RQ-PCR as previously described (Shin et al., 2012). The relative expression level of the target genes was determined using the 2-Ct method, and GAPDH was used as the endogenous control gene. All primers used in the RQ-PCR assay are available upon request. Western blot analysis Cell extracts (30 g) were prepared in RIPA lysis buffer (Santa Cruz Biotechnology, Santa Cruz, CA) and separated on 12% SDS-PAGE gels. The expression level of the indicated proteins was assessed by probing with monoclonal antibodies specific to Sirt1, Oct4, Stella, Hdac1, Hdac2, Hdac3, Crebbp, Ep300, GST, HA, -actin (Santa Cruz Biotechnology), Snrpn, Dnmt3b (Abnova, Walnut, CA), Dnmt1, Dnmt3a, Dnmt3l, Acetylated-Lysine (Ac-K), Mbd3, Mecp2 (Cell Signaling Technology), Dmap1 (Proteintech, Chicago, IL), Sox2, Dazl (Epitomics, Burlingame, CA), Dlk1 (Enzo Life Sciences, Inc., Farmingdale, NY), Ddx3y (Novus Biologicals, Littleton, CO), Uty, Nanog, Tet2 (Abcam, Cambridge, UK), Tet1 (Millipore), Tet3 (GeneTex, Inc., Irvine, CA), acetylated histone 3 (H3Ac), Mvh (Millipore), and Flag epitope (Sigma-Aldrich). To prepare nuclear fractions, cells were subjected to lysis using homogenate buffer (10 mM Tris-Cl [pH 7.4], 10 mM KCl, 3 mM MgCl2, 0.3% NP-40) and further centrifuged at 400 g for 5 minutes at 4oC. The nuclear pellets were sonicated under nuclear fraction lysis buffer (20 mM Tris-Cl [pH 7.9], 420 mM NaCl, 0.2 mM EDTA, 10% glycerol, 2 mM DTT) and further centrifuged at 12,000 g for 10 minutes at 4oC. All of the lysis buffer used in protein extracts was supplemented with the protease and phosphatase inhibitor cocktails (Roche, Indianapolis, IN) and 2.5 mM NaB (Millipore). To quantify the density of the indicated protein bands, quantitative digital image analysis was performed using ImageJ software (National Institute of Mental Health, Bethesda, MD). Relative protein expression was calculated by normalization to -actin. Immunoprecipitation and GST pull-down assay

For immunoprecipitation (IP), whole cell or nuclear extracts were prepared using IP lysis buffer (50 mM Tris-Cl [pH 7.4], 0.5% NP-40, 150 mM NaCl, 1.5 mM MgCl2, 2 mM DTT, 2 mM EGTA) supplemented with the protease/phosphatase inhibitor mixtures and 2.5 mM NaB, then centrifuged (12,000 g for 10 minutes at 4 oC). The extracts were incubated with ANTI-FLAG M2 Magnetic Beads (Sigma-Aldrich) or Protein G Magnetic Bead (Millipore) and mixed with 1 g antibodies for 3 hours at 4oC in the absence or the presence of 200 units of Benzonase Nuclease (Sigma-Aldrich). The immunoprecipitated proteins were washed 4 times with IP lysis buffer, and the bound proteins were eluted with 3FLAG peptide (Sigma-Aldrich) or 0.1 M Glycine-HCl (pH 3.0) buffer according to the manufacturer's instructions. For immunodetection of the IP products, mouse or rabbit IgG-HRP TrueBlot (eBioscience, San Diego, CA) was used to prevent interference from the immunoglobulin heavy and light chains included in the IP products. For the GST pull-down assays, cDNA fragments or full-length murine Dnmt3l (Addgene plasmid 13365) (Takahashi and Yamanaka, 2006) were cloned into pGEX-4T-1 (GE Healthcare Life Science, Piscataway, NJ), and the corresponding proteins were purified and bound to Glutathione-Sepharose beads (GE Healthcare Life Science) together with the Flag-tagged Sirt1 proteins which were produced using the TNT Quick Coupled in vitro Transcription/Translation system (Promega, Madison, WI) using 1g murine Sirt1 cDNA cloned into pCMV_3Tag-1 plasmid (Agilent Technologies, Santa Clara CA). The mixtures were incubated at room temperature for 1 hour and washed 4 times with IP lysis buffer, and the bound proteins were

analyzed using western blotting with the Flag and GST antibodies. Identification of the acetylated proteins via nano-LC-ESI-MS/MS analysis To identify two acetylated proteins with 50 kD molecular weight which were characteristically enriched in Sirt1-/- ESCs (Figure 5C), the acetylated proteins were enriched by IP of nuclear extracts of in Sirt1-

/- ESC with Ac-K antibody (Figure S4E). After SDS-PAGE and Coomassie Brilliant Blue Staining solution (Bio Rad), two acetylated bands were analyzed with nano-LC-ESI-MS/MS which was performed by Diatech Korea (Seoul, Korea). For enzymatic in-gel digestion, gel pieces were reduced using 10 mM DTT in 50 mM NH4HCO3 for 45 min at 56 oC, followed by alkylation of cysteines with 55 mM iodoacetamide in 50 mM NH4HCO3 for 30 min in dark. Finally, each gel pieces were treated with 12.5 ng/µL sequencing grade modified trypsin (Promega) in 50 mM NH4HCO3 buffer (pH 7.8) at 37 oC for overnight. Following digestion, tryptic peptides were extracted with 5% formic acid in 50% ACN solution at room temperature for 20 min. The supernatants were collected and dried with SpeedVac. Re-suspended samples in 0.1% formic acid were desalted using C18 ZipTips (Millipore) and dried using SpeedVac and kept in -80℃ till LC-MS analysis. For LC-MS/MS Analysis, Triple-TOFTM 5600+ (Sciex, Canada) coupled with an Eksigent NanoLC-2D+ with Nanoflex cHiPLC system was used for this study. Solvent A contained 0.1% formic acid (v/v) in water and solvent B contained of 0.1% formic acid (v/v) in 100% ACN. The samples were loaded onto a trap column (0.5 mm × 200 m) at a flow rate of 1 μL/min, and separated on an analytical column (15 cm × 75 μm, C18, 3μm, Thermo Fisher Scientific) with a linear gradient of 2% to 35% solvent B over 30 min at a flow rate of 400 nL/min on the Nanoflex cHiPLC system. The Chip nanoLC column was regenerated by washing with 60% solvent B for 50 min and equilibrating with 2% solvent B for 10 min. MS data was obtained using data-dependent acquisition (DDA) mode using a Triple-TOF 5600+ mass spectrometer with a 50-ms survey scan (TOF-MS) and 50-ms automated MS/MS scan for the 15 ions with the highest intensity. The MS/MS triggering criteria for parent ions were as follows: precursor intensity (> 150 counts) and charge state (> 1) with dynamic exclusion option (exclusion time: 6 s). Ions were isolated using a quadruple UNIT resolution (0.7 Da) and fragmented in the collision cell using collision energy ramped from 15 to 45 eV within the 50-ms accumulation time. For database searching and validation, all spectra generated from data-dependent acquisitions were searched against the Mus musculus database (Uniprot, taxonomy 10090) using ProteinPilot (version 5.0, Sciex) with the following search parameters: fully tryptic digestion, precursor ion and fragment ion mass tolerance for high-resolution Triple-TOF 5600, fixed modifications for cysteine (+57 Da: carbamidomethylation) and biological modifications/artifact such as methionine oxidation (+16 Da).

For acetylation site determination, resulting raw files were processed using Proteome Discoverer (version 1.4, Thermo) for identification with the database of Mus musculus (Taxon identifier: 10090, 2016.11 version, 82,199 entries, UniProt). The search parameters were set as default including cysteine carbamidomethylation (+57.021 Da) at cysteine residue, acetylation (+42.011 Da) at lysine residue, phosphorylation (+79.966 Da) at serine and threonine residue, methylation (+14.016 Da) at lysine residue as variable modifications with 2 miscleavages. Peptide identification was based on a search with an initial mass deviation of the precursor ion of up to 10 ppm, and the allowed fragment mass deviation was set to 0.6 Da. Maximum Delta Cn is 0.05 and Target false positive discovery rate is 0.01. Ectopic expression

To overexpress the Flag-tagged Sirt1 protein, murine Sirt1 cDNA (Addgene plasmid 8438) (Rodgers et al., 2005) was subcloned into the pCMV_3Tag-1 vector. ESCs that stably expressed the plasmids was established by transfection using Lipofectamine 2000 (Invitrogen), followed by selection under 1 mg/mL G418 Geneticin (Invitrogen) for 2 weeks. Murine Dnmt1, Dnmt3a, Dnmt3b (Open Biosystems, Pittsburgh, PA), and Dnmt3l cDNA were subcloned into the pENTR4 plasmid (Invitrogen) modified by including CMV early enhancer/chicken β actin (CAG) promoter and two tandom HA epitope tags to generate HA-tagged proteins. To rescue the Sirt1 protein in its non-tagged form, murine Sirt1 cDNA was cloned into the pLEX307 lentiviral vector (Addgene plasmid 41392) using the Gateway Technology reaction in accordance with the manufacturer's instructions (Invitrogen). Lentivirus was produced using a four-plasmid transfection system (Invitrogen). Two days after transfection into the 293FT packaging cell line, supernatants containing recombinant pseudo-lentiviral particles were collected and concentrated by precipitation using Lenti-X Concentrator kit (Clontech, Mountain View, CA). The concentrated virus was infected into Sirt1-/- ESCs using 6 g/mL polybrene (Invitrogen), and the rescued cells were selected by maintaining the cells for 3 weeks in the presence of 1 g/mL puromycin (Invitrogen). The effects of ectopic expression were examined using RQ-PCR and western blot analysis.

RNA interference (RNAi)

For the RNAi-mediated gene knock-down (KD) assay, shRNAs designed to target Dnmts were cloned into the pSicoR lentivrial vector (Addgene plasmid 12084) as previously described (Ventura et al., 2004). Lentiviral delivery of these shRNAs and the establishment of stable cell lines were performed using similar procedures. The sequences of the top and bottom oligonucleotides in each shRNA are indicated as following.

Dnmt1 GGAGTGTGTGAGGGAGAAA

Dnmt3a GCAGACCAACATCGAATCC

Dnmt3b GCTCTGATATTCTAATGCCAA

Dnmt3l GGAAGAAGAGTATCTGCAAGC

Clustered, regularly interspaced, short palindromic repeat (CRISPR)-Cas9 system based gene knock-out

For the CRIPSR-Cas9 system, guide RNAs (gRNA) designed to target Sirt1 or Dnmt3l were cloned into the pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene plasmid 48139) as previously described(Ran et al., 2013). The transfection and establishment of ESC cell lines stably expressing the RNA-guided Cas9 nuclease were performed as aforementioned. The sequences of each guide RNA are indicated as following.

Sirt1 GTTGATTGTGAAGCTGTTCG

Dnmt3l CGAGTGTGTGGACATCCTGG

Immunostaining

The EB spheres that formed in the indicated days or teratoma tumor containing tissues were fixed with 4% paraformaldehyde (Sigma-Aldrich) for 24 hours, embedded into paraffin blocks, and cut into 3-m sections using a microtome. The emergence of germ cells was determined using immunofluorescent analysis using anti-SSEA-1, -EMA-1, and -FE-J1 mouse IgM monoclonal antibodies (DSHB, Iowa City, IA) and visualized using FITC-conjugated anti-mouse IgM antibodies (Thermo Fisher Scientific). Nuclei were counterstained with DAPI. The stained samples were photographed using an inverted fluorescence microscope (Zeiss AxioObserver.Z1, Carl Zeiss Microscopy, Munich, Germany).

For histological analysis of teratomas, 20 slides for each tumor, containing various parts of the tumor (20 slides for each tumor) were stained with hematoxylin and eosin, and subjected to histological analysis by a certified pathologist. The undifferentiated cells in tumor tissues were stained using immunofluorescent analysis using anti-SSEA-1 mouse IgM monoclonal antibody.

Fluorescence-activated cell sorting (FACS) analysis

The cell suspension derived from the EBs on the indicated days was prepared using StemPro Accutase (Thermo Fisher Scientific), as previously mentioned. In total, 2.5 105 cells were fixed and permeabilized using the BD Cytofix/Cytoperm Fixation/Permeabilization Kit (BD Biosciences, Mountain View, CA), and then stained with the antibodies for 1 hour at room temperature. The stained cells were washed once and analyzed using the BDFACS Canto II flow cytometer (BD Biosciences). The following antibodies were used to stain the cells: anti-SSEA-1 PE-conjugated (clone MC-480, Millipore), anti-EMA-1 and -FE-J1 mouse IgM antibodies (DSHB), and FITC-conjugated anti-mouse IgM antibodies (Thermo Fisher Scientific). FACS sorting of meiotic male germ cells

Testicular tissues were prepared from pathogen-free, 8-week-old male C57BL/6 mice (Orient Bio, Seungnam, Korea). The cell suspension was derived from the testis or 20-day-old EB spheres and prepared using StemPro Accutase. Cell clumps were removed using a 70-M strainer (BD Biosciences). The cells were fixed and permeabilized using the BD Cytofix/Cytoperm Fixation/Permeabilization Kit (BD Biosciences), and stained using the FE-J1 antibody with the DNA-binding dye DAPI. The haploid FE-J1+ cell population was sorted using the BD FACSARIA III sorter (BD Biosciences), and gDNA was isolated from the sorted cells to analyze the DNA methylation status of sperm-specific genomic imprinting. Murine Dnmt3l promoter activity assay

The Dnmt3l-luciferase plasmid was generated by amplifying the 2 kb region upstream of the transcription starting site (TSS) (+1) of the murine Dnmt3l gene using PCR, and then cloned into the pGL4-Basic plasmid upstream of the firefly luciferase gene (XhoI and HindIII sites) (Promega). The sequences of the cloning primers used are described as following. Each construct was cotransfected with a vector expressing -galactosidase. After 24 hours of transfection into ESC or MEF cells using Lipofectamine 2000 (Invitrogen), promoter activity was measured using the luciferase assay kit (Promega) and normalized to an equivalent

amount of -galactosidase activity. Primers used for cloning of murine Dnmt3l promoters

Dnmt3l_Pr_F CTCGAGCTCTCCCACTGTCTCAGGCAG

Dnmt3l_Pr_R AAGCTTACAGCAGGGTCGTCAGAACC

Supplemental References Adli, M., Zhu, J., and Bernstein, B.E. (2010). Genome-wide chromatin maps derived from limited numbers of hematopoietic progenitors. Nat. Methods 7, 615-618. Bain, G., Kitchens, D., Yao, M., Huettner, J.E., and Gottlieb, D.I. (1995). Embryonic stem cells express neuronal properties in vitro. Dev. Biol. 168, 342-357. Conner, D.A. (2001). Mouse Embryo Fibroblast (MEF) Feeder Cell Preparation. (John Wiley & Sons, Inc.). Hahnel, A.C., and Eddy, E.M. (1986). Cell surface markers of mouse primordial germ cells defined by two monoclonal antibodies. Gamete Res. 15, 25-34. Johnson, W.E., Li, W., Meyer, C.A., Gottardo, R., Carroll, J.S., Brown, M., and Liu, X.S. (2006). Model-based analysis of tiling-arrays for ChIP-chip. Proc. Natl. Acad. Sci. U. S. A. 103, 12457-12462. Keller, G.M. (1995). In vitro differentiation of embryonic stem cells. Curr. Opin. Cell Biol. 7, 862-869. Mitchell, N., DeAngelis, J.T., and Tollefsbol, T. (2011). Methylated-CpG Island Recovery Assay. In Epigenetics Protocols. T.O. Tollefsbol, ed. (Humana Press), pp. 125-133. Ran, F.A., Hsu, P.D., Wright, J., Agarwala, V., Scott, D.A., and Zhang, F. (2013). Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8, 2281-2308. Rodgers, J.T., Lerin, C., Haas, W., Gygi, S.P., Spiegelman, B.M., and Puigserver, P. (2005). Nutrient control of glucose homeostasis through a complex of PGC-1 alpha and SIRT1. Nature 434, 113-118. Shin, D.M., Liu, R., Wu, W., Waigel, S.J., Zacharias, W., Ratajczak, M.Z., and Kucia, M. (2012). Global gene expression analysis of very small embryonic-like stem cells reveals that the Ezh2-dependent bivalent domain mechanism contributes to their pluripotent state. Stem Cells Dev 21, 1639-1652. Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676. Ventura, A., Meissner, A., Dillon, C.P., McManus, M., Sharp, P.A., Van Parijs, L., Jaenisch, R., and Jacks, T. (2004). Cre-lox-regulated conditional RNA interference from transgenes. Proc. Natl. Acad. Sci. U. S. A. 101, 10380-10385.

Uncropped Western blots. Dotted red line boxes indicate the cropped areas shown in the figures. In all the uncropped western

blot images the membranes were simultaneously or sequentially blotted with the indicated antibodies.