Supplementary Materials for

Amelioration of sepsis by TIE2 activation–induced vascular protection

Sangyeul Han,* Seung-Jun Lee, Kyung Eun Kim, Hyo Seon Lee, Nuri Oh, Inwon Park,

Eun Ko, Seung Ja Oh, Yoon-Sook Lee, David Kim, Seungjoo Lee, Dae Hyun Lee,

Kwang-Hoon Lee, Su Young Chae, Jung-Hoon Lee, Su-Jin Kim, Hyung-Chan Kim,

Seokkyun Kim, Sung Hyun Kim,| Chungho Kim, Yoshikazu Nakaoka, Yulong He,

Hellmut G. Augustin, Junhao Hu, Paul H. Song, Yong-In Kim, Pilhan Kim, Injune Kim,

Gou Young Koh*

*Corresponding author. E-mail: gykoh@kaist.ac.kr (G.Y.K.); syhan69@gmail.com (S.H.)

Published 20 April 2016, Sci. Transl. Med. 8, 335ra55 (2016)

DOI: 10.1126/scitranslmed.aad9260

This PDF file includes:

Materials and Methods

Fig. S1. ABTAA binds to human and mouse ANG2.

Fig. S2. ABTAA activates TIE2 and its downstream effectors in human lung ECs.

Fig. S3. ABTAA stimulates internalization of TIE2.

Fig. S4. ABA and ABTAA have different effects on survival of wild-type and

Ang1/ septic mice in the pretreatment setting.

Fig. S5. Constitutive expression of ANG1 is critical for basal and ABTAA-

induced TIE2 activity.

Fig. S6. Circulating ANG2 concentrations are very low in Ang2/ mice.

Fig. S7. ABTAA has a longer half-life and is more effective than COMP-Ang1

for improving survival from sepsis.

Fig. S8. ABTAA protects against major organ injury and microvascular

disintegration.

Fig. S9. Pretreatment with ABA or ABTAA mitigates parenchymal injuries and

microvascular disintegration.

Fig. S10. Intravital microscopy was used to measure the pulmonary endothelial

glycocalyx.

Fig. S11. ABTAA reduces pulmonary vascular leakage.

Fig. S12. Pretreatment with ABTAA blunts the cytokine storm in sepsis.

Fig. S13. Posttreatment with ABTAA does not attenuate cytokine storm in the

primary endotoxemia model.

www.sciencetranslationalmedicine.org/cgi/content/full/8/335/335ra55/DC1

Fig. S14. Pretreatment with ABTAA blunts ANG2 surge in sepsis.

References (60–70)

Other Supplementary Material for this manuscript includes the following:

(available at www.sciencetranslationalmedicine.org/cgi/content/full/8/335/335ra55/DC1)

Table S1 (Microsoft Excel format). Raw data for graphs.

Movie S1 (.mp4 format). Posttreatment with ABTAA rejuvenates septic mice.

Supplementary Materials and Methods

Mouse immunization with human ANG2

Five-week-old BALB/c mice (Japan SLC, Inc.) were immunized with recombinant human

ANG2 (100 g/injection, R&D Systems) mixed with CpG (10 g/injection, Sigma) as an

adjuvant twice weekly for 6 weeks. Anti-ANG2 antibody titers in the sera of immunized mice

were examined by ANG2 ELISA kit (R&D Systems). Splenocytes from several high titer

mice were fused with P3 myeloma cells, the cell mixture was seeded in 96-well plates at a

concentration of 2×105/ml, and the culture supernatants were tested by ANG2 ELISA 14 days

later. Hybridoma pools showing a positive signal were selected for clonal selection through

limiting dilution. Finally, about 40 monoclonal hybridoma lines were established. Among

them, several ANG2-binding antibodies showed unexpected TIE2-activating activity. One of

these antibodies was selected based on high affinity to human ANG2 and cross-reactivity to

mouse ANG2, later processed for humanization and affinity maturation, and named ABTAA

(ANG2 binding and TIE2 activating antibody).

Screening of a phage scFv antibody library

Fully human ANG2-binding antibodies were generated by screening a recombinant scFv

antibody library with recombinant human ANG2 (60). For the first round of panning, a

MaxiSorp immunotube (Nunc) was coated with human ANG2 (10 μg/ml, R&D Systems) for

16 hours, blocked with 3% (v/v) skim milk in PBS for 1 hour, incubated with phage particles

displaying scFv antibodies [1012 cfu, 1 ml of 3% (v/v) skim milk-PBS) for 1 hour, and

washed 5 times with 0.1% (v/v) Tween 20 in PBS. The bound phages were eluted with 1 ml

of 100 mM triethylamine and neutralized with 0.5 ml of 1 M Tris (pH 7.4). Eluted phages

were then amplified by transduction into E.coli ER2537 cells (New England Biolabs), and

harvested for 2 more rounds of panning, which were performed using lower concentrations of

human ANG2 (1 μg/ml and 0.1 μg/ml). Finally, 190 individual clones were randomly

selected and tested for their ANG2-binding activity by ANG2 ELISA, where about 40

antibodies were shown to inhibit the binding of human ANG2 to TIE2. One of those

antibodies showed a high affinity to human ANG2 and cross-reactivity to mouse ANG2 and

was selected for further study with the name of ABA (ANG2 binding antibody).

DNA constructs, protein expression, and purification

The fibrinogen-like domain of human ANG2 (amino acid residues 276-496) (A2D) was

cloned into pcDNA3.1 vector (Invitrogen). For A2D-Fc construct, A2D DNA was cloned as

an IgG-Fc fusion construct into pcDNA3.1 vector. For soluble TIE2-Fc construct, the

extracellular domain (ECD) of TIE2 (amino acid residues 1-452), which contains three Ig

(Ig1-Ig3) domains and three EGF (EGF1-EGF-3) domains, was cloned as an IgG-Fc fusion

construct (T2E) into pcDNA3.1 vector. A thrombin cleavage site was introduced between

TIE2-ECD and Fc portion to facilitate the generation of TIE2-ECD. Purified TIE2-Fc fusion

proteins were digested with thrombin (Sigma), and Fc portion was removed using MabSelect

Sure affinity chromatography (GE Healthcare) to prepare TIE2-ECD. To prepare ABTAA-

Fab, purified ABTAA was digested with papain (Sigma), and Fc portion was removed using

Hitrap Protein-A column (GE Healthcare). To generate the DNA construct of REGN910

antibody (34), the DNA sequences of the variable regions of heavy and light chains were

adopted from Thurston et al (61) and used to synthesize the DNA fragments of the variable

regions (Bioneer). These DNA fragments of the heavy and light variable regions were then

cloned into the pOptiVEC and the pcDNA3.3 vectors, respectively, which were included in

the OptiCHO Antibody Express kit (Invitrogen). Transient expression of diverse DNA

constructs was carried out using Expi293F cells and ExpiFectamine293 Transfection kit

(Invitrogen) according to the manufacturer’s instructions. Briefly, 100 ml of Expi293F cells

(2 X 106 cells/ml) were incubated with the mixture of cDNA (100 μg) and ExFectamine 293

(0.27 ml) in 10 ml of OptiMEM (Invitrogen) for 30 min, and, at 18 hours after transfection,

cells were treated with Enhancer 1 (0.5 ml) and 2 (5 ml) (Invitrogen). At day 5 after

transfection, culture supernatants were collected and centrifuged at 4,000 g for 15 min to

remove cells. Recombinant proteins or antibodies in the clear supernatants were purified

using AKTA Prime plus (GE Healthcare) equipped with Hitrap MabSelect SuRe (GE

Healthcare). Then the buffers were replaced with PBS using Amicon Ultra centrifugal filters

(Millipore) and microfiltered with syringe filers (0.22 μm, Thermo Scientific). The purified

aliquots of proteins/antibodies were aliquoted and stored at -80°C.

Enzyme-linked immunosorbent assay (ELISA)

A 96-well MaxiSorp flat-bottom plate (Nunc) was coated with 5 μg/ml of His-tagged human

ANG2, human ANG1, or mouse ANG2 (R&D Systems) at 4°C for 16 hours, washed 5 times

with 0.05% (v/v) Tween-20 in PBS, and then blocked with 1% (v/v) BSA in PBS at RT for 2

hours. Periplasmic fractions of transduced E.coli or purified monoclonal antibodies were

added to each well of the plate, allowed to react at RT for 2 hours, and washed 5 times with

PBS/0.05% Tween-20 in PBS. Plates were incubated with 1:1000 diluted secondary antibody

conjugated with HRP (Santa Cruz) for 1 hour, washed 5 times with 0.1% (v/v) Tween-20 in

PBS, and developed with TMB substrate (3,3’,5,5’-tetramethylbenzidine, Cell Signaling).

Reaction was stopped by Stop solution (Cell Signaling), and OD450 values were measured

with a Spectra MAX340 plate reader (Molecular Devices). For ANG2/TIE2 or ANG1/TIE2

competitive ELISA, 96-well MaxiSorp flat-bottom plates (Nunc) were coated with 4 g/ul of

human TIE2-Fc, and either 400 ng/ml of His-tagged human ANG2 or His-tagged human

ANG1 were added to the plates along with the indicated antibodies. Anti-His antibody

conjugated with HRP was used as a secondary antibody. To examine ABTAA/ANG2/TIE2

complex formation, ABTAA (2 g/ml) and His-tagged human ANG2 were added to the 96-

well plates coated with 100 l of human TIE2-Fc (4 mg/ml) and incubated at RT for 2 hours.

The plate was washed 5 times with 0.1% Tween-20 in PBS, and 1:5,000 diluted anti-human

IgG antibody conjugated with HRP (Cell Sciences, Inc.) was used as a secondary antibody to

detect the bound ABTAA.

Surface plasmon resonance (SPR)

SPR analyses were run using a Biacore T100 (GE Healthcare) instrument. Anti-histidine

antibody (R&D Systems) was immobilized on a Series S CM5 sensor chip (GE Healthcare)

docked in Biacore T100. The C-terminal histidine-tagged human ANG2 (R&D Systems) was

captured, followed by injection of ABTAA. For the kinetic titration experiment, a 2-fold

concentration series (12.5, 25, 50, 100, 200, and 400 nM) was injected for 3 min at a flow

rate of 30 L/min, and dissociation was monitored for another 3 min. All experiments were

performed at 25°C using HBS-P (GE Healthcare) as a running buffer. Data sets were

processed and analyzed using the Biacore T100 Evaluation Software.

Size exclusion chromatography

Purified fibrinogen-like domain of human ANG2 (A2D, 276-496) and T2E (1-452) were

mixed at a 2:1 molar ratio (60 M of A2D and 30 M of TIE2) and incubated at RT for 1

hour. The mixture was loaded onto a Superdex 200 10/300 GL column (GE Healthcare)

equilibrated with PBS. The fractions containing A2D:T2E complex were pooled,

concentrated, mixed with ABTAA at a 2:1 molar ratio (40 M of A2D:T2E and 20 M of

ABTAA), and incubated at RT for 1 hour. The mixture was loaded onto a Superdex 200

10/300 GL column (GE Healthcare) equilibrated with PBS. Peak fractions were collected and

analyzed by non-reducing SDS-PAGE. For analysis of A2D-Fc and ABTAA complex

formation, purified A2D-Fc (8.5 M) and ABTAA (6.8 M) were mixed with the indicated

molar ratios and incubated at RT for 1 hour. The mixture was analyzed as above using a

Superdex 200 10/300 column (GE Healthcare).

Multi-angle light scattering (MALS) analysis

The molecular mass of ABTAA bound to A2D-T2E or A2D-Fc was determined by

quantitative analyses using MALS. Each sample (5 mg/ml, PBS pH 7.4) was injected into a

WTC-050S5 column (Wyatt Technology) coupled to 18-angle light scattering detector

(DAWN HELEOS II) and a refractive index detector (Optilab T-rEX) (Wyatt Technology).

All data were collected at 25oC (0.5 ml/min flow rate) and analyzed using ASTRA 6

software.

Immunoprecipitation and immunoblot analysis

For TIE2 immunoprecipitation, HUVECs were seeded into 100 mm culture dishes and grown

to confluence. HUVECs were starved for 6 hours and then incubated with either 0.2 μg/ml

human ANG1 (R&D Systems) or 2 μg/ml human ANG2 (R&D Systems) in the presence of

ABTAA or ABA for 15 min. Cells were rinsed once with cold PBS and lysed in cold

complete lysis-M buffer (Roche) containing protease and phosphatase inhibitors (Roche).

The lysates were centrifuged at 14,000 g at 4°C for 15 min, and supernatants were subjected

to immunoprecipitation with anti-TIE2 antibody (R&D Systems). The immunoprecipitates

were incubated with 20 μl of pre-washed Protein A agarose beads (GE Healthcare) for 2

hours. Beads with immunoprecipitates were washed 3 times with cold lysis buffer, heated in

NuPAGE sample buffer (Invitrogen) at 95°C for 5 min, subjected to SDS-PAGE on 4–12%

NuPAGE Bis-Tris gels (Invitrogen), transferred to nitrocellulose membrane (Invitrogen), and

probed with horseradish peroxidase (HRP)-conjugated anti-phosphotyrosine 4G10 antibody

(Millipore). The blots were developed using the ECL Western blotting detection kit (GE

Healthcare) and visualized with Image Quant LAS 4000 mini (GE Healthcare). The

membranes were stripped and re-probed with anti-TIE2 (Santa Cruz) antibody. The primary

antibodies for pAKT (S473), AKT, pERK (Y202/204), ERK, pMLC (S19/T18), and GAPDH

(all from Cell Signaling) and ANG2 (Abcam) were used. The secondary HRP-conjugated

antibody (Bio-Rad) was used for signal detection. To examine in vivo TIE2 phosphorylation,

seven-week-old male C57BL/6J wild-type mice were intravenously injected with COMP-

ANG1 (50 μg), ANG2 (20 μg), ABTAA (10 mg/kg) + ANG2 (20 μg), or ABA (10 mg/kg) +

ANG2 (20 μg). COMP-Ang1 was produced as previously described (62). At 2 hours after

injection, lungs from the mice were harvested and processed for immunoprecipitation and

immunoblot analysis of TIE2 as described above.

Immunofluorescence staining for cultured ECs

Cells on µ-Slide 8 well (ibidi) were fixed with 4% formaldehyde in PBS at room temperature

(RT) for 15 min, permeabilized with 0.1% Triton X-100 in PBS, blocked with 1% BSA in

PBS at RT for 15 min, and incubated with primary antibodies at RT for 3 hours. The primary

antibodies for phospho-FOXO1 (S256 and T24), FOXO1, and EEA1 (Cell Signaling),

phospho-TIE2 and TIE2 (R&D Systems), anti-VE-cadherin (eBioscience), and rhodamine-

conjugated anti-phalloidin antibody (Molecular Probes) were used. The cells were then

incubated with secondary antibodies (Invitrogen) in the dark at RT for 1 hour and mounted

with Vectashield mounting medium with DAPI (Vector Labs). Images were taken with a

confocal laser scanning microscope (LSM7, Carl Zeiss).

Cell culture and transfection

Human umbilical vein endothelial cells (HUVECs, Lonza) and human lung endothelial cells

(HLECs, Lonza) were maintained in EGM-2 medium supplemented with 2% FBS (Lonza)

and cultured in humidified incubators at 37°C and 5% CO2. Expi293F cells (Invitrogen) were

maintained in Expi293 Expression medium (Invitrogen) and cultured in humidified shaking

incubators at 37°C and 8.5% CO2. For Tie2 knockdown experiments, HUVECs were plated

in 6-well plates to 80% confluence, and 24 hours later, confluent cells were transfected with

either 50 pM of ON-TARGETplus Human Tie2 siRNA SMARTpool (L-003178-00,

ThermoScientific/Dharmacon) or ON-TARGETplus Non-targeting Control Pool (D-001810-

10, Dharmacon) using Lipofectamine RNAiMAX (Life Technology/Invitrogen), according to

the manufacturer’s instructions.

Mice

Specific pathogen-free (SPF) C57BL/6J mice were purchased from the Jackson Laboratory

and transferred to our SPF facilities. Ang1flox/flox (22, 63), Ang2flox/flox (64), and Tie2flox/flox (65)

mice were transferred and bred in the SPF facility of KAIST. To globally knock down floxed

genes in a tamoxifen-dependent manner, Ang1flox/flox, Ang2flox/flox, and Tie2flox/flox mice were

intercrossed with Rosa26-CreERT2 mice. Tamoxifen (Sigma-Aldrich) was dissolved in corn oil

(Sigma-Aldrich), and the resulting solution (2 mg) was subcutaneously injected three times at

days 0, 2, and 4 to these genetically modified 5-week-old mice. All mice were anesthetized

through an intraperitoneal injection of a combination of anesthetics (80 mg/kg ketamine, 12

mg/kg xylazine) before any procedures. Animal care and experimental procedures were

performed under the approval (KA2011-22) of the Animal Care Committee of KAIST.

High-grade CLP sepsis model and treatment regimen

Seven-week-old male C57BL/6J wild-type or genetically modified mice (22-25 g body

weight) were subjected to high-grade CLP by a single experienced operator. After anesthesia,

75% of the cecum was ligated using 4-0 black silk and punctured with a 21-gauge needle.

After puncturing, the cecum was gently squeezed to ensure the patency of holes by observing

the extrusion of feces. Then the cecum was placed back into the abdominal cavity and the

abdominal incision was closed with 6-0 nylon sutures. After this procedure, 1 ml of pre-

warmed saline per 20 g body weight was subcutaneously administered. Sham-treated mice

underwent the same procedures except for the ligation and puncture of the cecum. For

survival analysis in a pre-treatment setting, the indicated doses of ABTAA or ABA were

intravenously administered to mice via the tail vein, and the animals were randomized 1 hour

before high-grade CLP. In a therapeutic post-treatment setting, the mice were treated with

consecutive administrations of the indicated doses of ABA or ABTAA at 6 and 18 hours after

CLP. As a control, equal amounts of IgG Fc were injected in the same manner. For

combination treatment, indicated doses of Fc or ABTAA were given once intravenously at 6

hours after CLP, and imipenem/cilastatin (20 mg/kg) was given 6 times every 12 hours

starting at 6 hours after CLP. We assessed the animals’ survival every 6 hours for the initial

48 hours after high-grade CLP, and then every 8 hours for another week. All these procedures

were performed in a blind manner.

LPS endotoxemia and S. aureus bacteremia models

To generate the LPS-induced endotoxemia model, LD75 dose (10 mg/kg, intraperitoneal) of

LPS derived from Escherichia coli, serotype O111:B4 (Sigma), was given to male mice

(C57BL/6J, 7-9 weeks old). To generate the bacteremia model, LD90 dose (1 x 109 CFU,

intraperitoneal) of Staphylococcus aureus subsp. aureus Rosenbach (ATCC 25923) was

given to male mice (C57BL/6J, 7-9 weeks old). The bacteria were grown overnight in

nutrient broth at 37°C, diluted 1:100 into fresh broth, and incubated until they reached an

OD600 of 0.5. The bacteria were centrifuged at 7,000 g, washed, and suspended in 300 l of

PBS.

Micro-computed tomography (micro-CT)

Micro-CT was performed with the Quantum GX micro-CT imaging system (PerkinElmer) to

assess pulmonary edema in the mice. The mice were anesthetized with 1.5% isoflurane, and

respiration was monitored during the scan. Micro-CT acquisition parameters were set to 90

kV, 160 mA, and 12-ms exposure per projection. A total of 512 projections were acquired

with a 0.725-degree increment for a total rotation angle of 370 degrees. Acquired images

were converted to hounsfield units (HU) by scaling air selected from a region outside the

animal to -1000 HU and water to 0 HU. The area between -300 and -100 HU, which was

considered to be the leakage area, was calculated and pseudo-colored using ImageJ software

(http://rsb.info.nih.gov/ij). For statistical analysis, 4 sections were selected from each mouse

starting from the pulmonary artery bifurcation to the caudal side with an interval of 1 mm

thickness, and the average values of relative leakage area for the whole lung were compared.

Pharmacokinetic analysis

ABTAA (1 mg/kg) or COMP-Ang1 (5 mg/kg) was intravenously administered into the tail

veins of male, 10-week-old Sprague Dawley rats (n = 5 per each), followed by blood

collection at 20 time points (1, 3, 5 10, 20, 30, 40, 50 min, 1, 2, 4, 8, 24, 48, 72, 96, 120, 144,

168, 240 hours) via the retro-orbital sinus under methoxyflurane anesthesia. Plasma samples

for ABTAA (50 l, 1:100 diluted in 1% BSA) were added into the 96 wells of Maxisorp

immune-plate (Nunc) coated with goat anti-human IgG (Fc specific) antibody (Sigma-

Aldrich), incubated for 1 hour, and washed 3 times with 0.1% Tween-20/PBS (PBS-T). Goat

anti-human IgG (F(ab’)2-specific antibody conjugated to horseradish peroxidase (Sigma-

Aldrich) was added, incubated for 1 hour, and washed 3 times with PBS-T. TMB substrate

solution was added for color development and O.D. at 450 nm was measured using an ELISA

plate reader (Molecular Devices). The same procedure was applied for determination of

COMP-Ang1 concentration in plasma samples, except that a soluble TIE2-Fc coated plate

and anti-FLAG M2 monoclonal antibody conjugated to horseradish peroxidase (Sigma-

http://rsb.info.nih.gov/IJ

Aldrich) were used instead, because COMP-Ang1 recombinant protein is FLAG-tagged (21).

Data were analyzed with a validated two-compartmental modeling software developed by

Samsung Advanced Institute of Technology. Data were fitted by nonlinear least squares

analysis using the pharmacokinetic bi-exponential disposition function, and the curve fits

yielded various parameters, including the beta half-life (t1/2, ).

Intravital microscopy for pulmonary endothelial glycocalyx

For in vivo lung endothelial glycocalyx visualization, we adapted a modified lung window

with a micro-suction device chamber (66) (fig. S10A). Mice were anesthetized with ketamine

(80 mg/kg) and xylazine (12 mg/kg), intubated, and then connected to a mechanical ventilator

(MouseVent). For intravenous injection, the tail vein was cannulated with a 30-gauge needle

attached to PE-10 tubing. The lung was exposed by careful excisions of the skin, muscle, and

3rd and 4th rib of the right thorax on the right decubitus position. After attaching the

pulmonary window suction chamber on the lung, 30~40 mmHg of suction pressure was

applied on the chamber to stabilize the lung surface (fig. S10A). For visualization of the

endothelial surface layer (ESL) of the lung microvasculature, FITC-conjugated dextran (40

kDa, Sigma-Aldrich) was injected into the tail vein, and images were captured using a

custom-designed, video-rate laser scanning confocal microscope (67, 68). We randomly

selected 10 areas of sub-pleural vessels from each mouse and acquired z-stack slices of the

whole vessel. Images were displayed and stored at an acquisition rate of 30 frames per second

with 512 x 512 pixels per frame. The most uninterrupted frame in the movie with the widest

visible vessel width, which represents the central portion of the micro-vessel, was acquired.

We then averaged the noise over 30 frames using a MATLAB program to improve contrast

and signal-to-noise ratio. The outlines of the capillary and RBC track were identified, and the

ESL thickness was determined by calculating the difference in the diameter of the RBC track

and the micro-vessel and dividing by 2. This process was done by a blinded observer using

ImageJ software (http://rsb.info.nih.gov/ij).

Histological analyses

At 24 hours after CLP, lungs and kidneys were harvested after perfusion-fixation and further

fixed overnight in 4% paraformaldehyde. For hematoxylin and eosin (H&E) staining, tissues

were processed using standard procedures, embedded in paraffin, and cut into 3 μm sections

followed by H&E staining. For immunofluorescence staining, samples were further processed

http://rsb.info.nih.gov/IJ

by dehydration in 15% and 30% sucrose, consecutively, and embedded in tissue freezing

medium (Leica). Frozen blocks were cut into 8 μm sections. For en face immunostaining,

isolated thoracic arteries were carefully incised and unrolled with a microneedle and

microscissors under the stereomicroscope. Samples were blocked with 5% goat or donkey

serum in PBS-T and incubated overnight at 4°C with the primary antibodies against CD31

(hamster monoclonal, clone 2H8; Millipore), VE-cadherin (rat monoclonal, clone 11D4.1;

BD Biosciences), NG2 (rabbit polyclonal; Millipore), TIE2 (goat polyclonal; R&D), pTIE2

(Y992, rabbit polyclonal; R&D systems), heparan sulfate (mouse monoclonal, clone F58-

10E4; Amsbio), perlecan (rat monoclonal, clone A7L6; US Biological), heparanase (rabbit

polyclonal; InSight), Gr-1 (rat monoclonal, clone RB6-8C5; eBioscience), and goat anti-

human IgG Fc (Jackson ImmunoResearch). After several washes, the samples were incubated

for 2 hours at RT with the following secondary antibodies obtained from Jackson

ImmunoResearch: FITC-, Cy3-, or Cy5-conjugated anti-hamster IgG; FITC- or Cy3-

conjugated anti-rabbit IgG; FITC- or Cy5-conjugated anti-rat IgG; or Cy3-conjugated anti-

goat IgG. Goat Fab fragment anti-mouse IgG antibody (Jackson ImmunoResearch) was used

to block endogenous mouse IgG to use mouse antibodies on mouse tissues. F-actin was

stained with actin-stain 555 phalloidin (Cytoskeleton). Nuclei were stained with 4’,6-

diamidino-2-phenylindole (DAPI, Invitrogen). Samples were mounted with fluorescent

mounting medium (DAKO), and immunofluorescence images were acquired with a Zeiss

LSM780 confocal microscope (Carl Zeiss).

Lung and tubular injury scoring

We assessed and scored lung injury in four categories: interstitial inflammation, neutrophil

infiltration, congestion, and edema (69). The scoring was as follows: 0 = minimal damage, 1

= mild damage, 2 = moderate damage, 3 = severe damage, and 4 = maximal damage. Lung

injury score was calculated by summing up the individual scores for each category. Renal

tubular injury was graded according to the percentage of cortical tubules with epithelial

necrosis (70). Renal tubular necrosis was defined as any of the following: loss of proximal

tubular brush border, blebbing of the apical membranes, detachment of tubular epithelial cells

from the basement membrane, or intraluminal aggregation of cells and proteins. The scoring

was as follows: 0 = no injury, 1 = less than 10%, 2 = 10 to 25%, 3 = 26 to 75%, and 4 =

higher than 75%. All scoring was based on a representative image out of 5 sections for each

tissue. Semi-quantitative morphometric examinations were performed in a blind manner by

two independent investigators.

Morphometric analyses

Density measurements of blood vessels, pericytes, adherens junctions, endothelial

glycocalyx, heparanase, neutrophil infiltration, lectin perfusion, antibody co-localization,

TIE2 phosphorylation, and leakage areas were performed with Image J software

(http://rsb.info.nih.gov/ij). To assess blood vessel density, we measured CD31+ area per 5

random 0.045 mm2 fields in the renal tubular region of 3-5 mice per group. Pericyte coverage

was calculated as NG2+ area divided by the total CD31+ EC area in 5 random 0.015 mm2

fields for each lung. Measurements of adherens junction density were made on the luminal

side of whole-mounted thoracic aorta tissue by calculating VE-cadherin+ area per 5 random

0.022 mm2 fields. Lung heparan sulfate (HS) density was calculated as HS+ area divided by

CD31+ EC area in 5 random 0.015 mm2 fields for each lung. Glomerulus perlecan density

was calculated as perlecan+ area divided by CD31+ EC area in 5 random 0.006 mm2 fields for

each glomerulus. Lung and glomerulus heparanase density was calculated as heparanase+ area

divided by total CD31+ EC area in 5 random 0.037 mm2 fields per lung and 5 random 0.006

mm2 fields per glomerulus. Neutrophil infiltration was counted as Gr-1+ cells per 5 random

0.025 mm2 fields for each lung. Lectin perfusion was calculated as FITC-lectin+ area divided

by total CD31+ EC area in 5 random 0.037 mm2 fields per lung and 5 random 0.006 mm2

fields per glomerulus. Antibody co-localization was calculated as CD31+/human IgG+ area

divided by total CD31+ EC area in 5 random 0.015 mm2 fields per lung. TIE2

phosphorylation was calculated as phospho-TIE2(Y992)+ area divided by total TIE2+ EC area

in 5 random 0.022 mm2 fields per lung. Vascular leakage was quantified as FITC-dextran+

area divided by total CD31+ EC areas in 5 random 0.027 mm2 fields per lung.

Quantitative Real-time RT-PCR

Total mRNAs were extracted from HUVECs or frozen tissues using RNeasy Mini kit

(QIAGEN), followed by cDNA synthesis using Transcriptor First Strand cDNA synthesis kit

(Roche) according to the manufacturer’s instruction. Quantitative PCR was performed with

Lightcycler 480 (Roche) using SYBR Green Master mix (Roche) and the following primer

sets: ICAM-1, 5’F CCTTCCTCACCGTGTACTGG and 3’R

AGCGTAGGGTAAGGTTCTTGC; VCAM-1, 5’F TGCACAGTGACTTGTGGACAT and

http://rsb.info.nih.gov/ij

3’R CCACTCATCTCGATTTCTGGA; E-selectin, 5’F ACCAGCCCAGGTTGAATG and

3’R GGTTGGACAAGGCTGTGC; HPRT-1, 5’F TGACCTTGATTTATTTTGCATACC

and 3’ CGAGCAAGACGTTCAGTCCT. Quantitative PCR result of HPRT-1 was used for

normalization.

In vitro EC layer permeability assay

In vitro EC layer permeability was assessed using HUVECs and In Vitro Vascular

Permeability Assay Kit (Millipore) according to the manufacturer’s instruction. HUVECs

were seeded into the insert of the trans-well plate and cultured for 2 days to become

confluent. The HUVECs were pre-incubated with ANG1 (0.2 μg/ml), ANG2 (1 μg/ml), or

ABTAA (10 μg/ml) plus ANG2 (1 μg/ml) for 30 min, and then TNF- (1.0 ng/ml) was added

and the cells were incubated at 37oC for 6 hours. FITC-dextran was added to the upper

chamber and incubated for 30 min. Passage of FITC-dextran though the HUVEC monolayer

was measured by Envision 2104 Multilabel Reader (PerkinElmer) at excitation and emission

wavelengths of 485 and 535 nm, respectively.

In vivo permeability assay

At 24 hours after CLP, mice were anesthetized and given an intravenous injection of Evans

blue albumin (EBA, 20 mg/kg) to measure pulmonary vascular permeability. Thirty min after

dye injection, mice were perfused with PBS through the right ventricle until blood was totally

eliminated. After perfusion, lungs were harvested, weighed, homogenized in 1 ml of

formamide, and then incubated at 55 ºC for 48 hours. Supernatants were collected after

centrifugation at 10,000 g for 20 min, and the EBA content was analyzed by measuring

absorbance at 620 nm. Results were calculated from a standard curve of EBA and expressed

as g of EBA per g of organ (wet weight). Alternatively, 200 μl of FITC-conjugated dextran

(5 mg/ml, 40 kDa, Sigma-Aldrich) was intravenously injected 30 min before sacrifice, and

then the lungs were snap frozen, sectioned, and stained for visualization of dextran and

pulmonary ECs by immunofluorescence staining

Lectin perfusion assay

For the lectin perfusion assay, 100 l of DyLight 488-conjugated tomato-lectin (1 mg/ml,

Vector Laboratory) was intravenously injected into the mice. Fifteen min later, the mice were

anesthetized and perfused by intra-cardiac injection of 1% PFA to remove intravascular lectin.

Vascular perfusion area was calculated as the percentage of lectin+ area divided by CD31+

EC area in random 0.038 mm2 regions.

Assays for serum cytokines and ANG2

Serum cytokines TNF- and IL-6, as well as ANG2, were measured by ELISA using

commercial kits (R&D Systems). At the indicated time points, blood samples were collected

by cardiac puncture, were allowed to clot for 2 hours at RT, and centrifuged at 2,000 g for 20

min at 4 °C.

The serum was diluted into a total volume of 400 μl and divided into two aliquots (200 μl for

each aliquot). One aliquot was immunodepleted to measure free ANG2, whereas the other

aliquot was used to measure total ANG2. Immunodepletion using protein-G-sepharose beads

was performed to eliminate all immunoglobulins including the administered antibodies,

ABTAA and ABA, in the serum, and it was then possible to detect antibody-free ANG2

distinctly from antibody-bound ANG2. For the immunodepletion, 100 μl of protein G slurry

(50% v/v protein G-Sepharose in PBS) was added to the aliquot, incubated at 4°C for 4

hours, centrifuged, and then the concentration of free ANG2 in the supernatant was

measured. The concentration of bound ANG2 was calculated by subtracting the concentration

of free ANG2 from the total ANG2 concentration measured by ELISA in the other aliquot

without immunodepletion.

Statistical analyses

Values are presented as mean ± standard error of the mean (SEM). Statistical differences

between means were determined by unpaired 2-tailed Student’s t-test, one-way ANOVA

followed by the Student-Newman-Keuls test, or the Mann-Whitney test, as appropriate.

Kaplan-Meier survival plots and log-rank tests were used to compare the survival results

between the treatment groups. Statistical significance was set at P < 0.05 or P < 0.01.

Original data are provided in table S1.

Fig. S1. ABTAA binds to human and mouse ANG2.

(A) Representative dose-response surface plasmon resonance sensograms of ABTAA binding to immobilized human ANG2. The antibody (Ab)

concentrations in each injection are indicated by different colors. (B) The ability of ABTAA or ABA to inhibit ANG2 binding to TIE2 was examined

by competitive TIE2 ELISA assay. Human TIE2-Fc-coated plates were incubated with human ANG2 along with ABTAA or ABA. The values

represent mean ± SEM of duplicates. (C) Representative surface plasmon resonance sensograms of ABA binding to immobilized human ANG2. (D)

Binding of ABTAA or ABA to mouse ANG2 was examined by ELISA. Recombinant mouse ANG2-coated plates were incubated with ABTAA or

ABA antibodies at various concentrations. The values represent mean ± SEM of duplicates. (E) ELISA analyses showing that neither ABTAA nor

ABA blocked the binding of human ANG1 to human TIE2.

Fig. S2. ABTAA activates TIE2 and its downstream effectors in human lung ECs.

Serum-starved, confluent HLECs were treated with COMP-Ang1 (A1, 500 ng/ml) or ANG2 (A2, 2 μg/ml) along with 10 μg/ml of ABTAA or ABA

for 30 min. (A) Representative immunoblots for phosphorylated and total TIE2, AKT, and ERK. (B) Immunofluorescence images showing that

ABTAA induces TIE2 translocation into cell-cell contacts. (C) ABTAA-induced nuclear clearance of FOXO1. All scale bars, 20 μm.

Fig. S3. ABTAA stimulates internalization of TIE2.

(A) Time-course images showing that ABTAA+ANG2 induce TIE2 endocytosis and co-localize with TIE2. HUVECs were serum-starved for 3

hours and treated with ABTAA (10 μg/ml) and human ANG2 (2 μg/ml). Magnified confocal images of the cell membrane (1, 2) and cytoplasmic

region (3, 4) are shown in the bottom panels. Arrowheads and arrows indicate the plasmalemmal and vesicular co-localization of TIE2 and ABTAA,

respectively. Scale bars, 10 μm. (B,C) Images and quantification analysis for endosomal localization of ABTAA/TIE2 complexes. Serum-starved

HUVECs were treated with human ANG1 (0.2 μg/ml, A1), human ANG2 (2 μg/ml, A2), ABTAA (10 μg/ml), or human ANG2 (2 μg/ml) plus

ABTAA (10 μg/ml) for the indicated times, fixed, and labeled for immunofluorescence analysis. Early endosome marker EEA1 co-localized with

ABTAA or TIE2. Magnified images of each boxed region (cytoplasmic region) are shown on the right for each image. Scale bars, 10 μm. (C)

Comparison of the percentage of TIE2 co-localized with EEA1 per total TIE2 at 60 min after treatment. Bars indicate mean ± SEM (n = 10 from 3

independent experiments). *P < 0.05 versus control. The P values were determined by one-way ANOVA followed by Student-Newman-Keuls post-

test.

Fig. S4. ABA and ABTAA have different effects on survival of wild-type and Ang1Δ/Δ septic mice in the pretreatment setting.

(A) Survival curves of wild-type mice treated with different doses of ABA, which was given 1 hour before CLP. (B) Survival curves of wild-type

mice treated with Fc, ABA, or ABTAA (10 mg/kg) 1 hour before CLP. (C) Fc, ABTAA (10 mg/kg), or high dosage (25 mg/kg) of ABTAA was

administered to Ang1Δ/Δ mice and their littermate controls 1 hour before CLP. Numbers in parentheses represent the number of surviving mice out of

total mice used for each group. Statistical significance was analyzed by a log-rank test.

Fig. S5. Constitutive expression of ANG1 is critical for basal and ABTAA-induced TIE2 activity.

(A,B) Fc or ABTAA (10 mg/kg) was given to ANG1-depleted (Ang1Δ/Δ) mice and their littermate controls (Ang1+/+) 6 hours after CLP. Ang1Δ/Δ mice

were also treated with high-dose ABTAA (hAT, 25 mg/kg). Lungs were harvested 2 hours after antibody injection and snap frozen for cryostat

sectioning. Immunofluorescence images and quantification analysis show the decrease in phosphorylated TIE2 in Ang1Δ/Δ mice, which was rescued

by hAT. Scale bars, 20 μm. Bars indicate means ± SEM (n = 3-4). $P < 0.05 versus Fc, Ang1+/+; *P < 0.05 versus Fc, Ang1Δ/Δ; #P < 0.05 versus AT,

Ang1Δ/Δ. The P values were determined by one-way ANOVA followed by Student-Newman-Keuls post-test.

Fig. S6. Circulating ANG2 concentrations are very low in Ang2Δ/Δ mice.

Blood samples were collected from ANG2-depleted mice (Ang2Δ/Δ) and Ang2+/+ control mice at 18 hours after sham surgery or CLP,

and serum ANG2 concentrations were measured with an ELISA kit. Bars indicate means ± SEM of the actual values (n = 6 for each

group). The P values were determined by one-way ANOVA followed by Student-Newman-Keuls post-test.

Fig. S7. ABTAA has a longer half-life and is more effective than COMP-Ang1 for improving survival from sepsis.

(A) Pharmacokinetic profiles for ABTAA and CA-1. ABTAA (300 μg/rat) or COMP-Ang1 (1,500 μg/rat) was intravenously injected into 10-week-

old male Sprague-Dawley rats (250-300 g), blood samples were taken at the indicated time points, and the plasma concentration of each agent was

measured by ELISA. Values are mean ± SEM (n=5). t1/2, , the terminal half-life. (B,C) Survival curves of septic mice treated with Fc, CA-1, or

ABTAA (10 mg/kg) 1 hour before CLP or intraperitoneal LPS injection. An additional dose of CA-1 (10 mg/kg) was given 6 hours after CLP or LPS

injection. Numbers in parentheses represent the number of surviving mice out of total mice used for each group. Statistical significance was analyzed

by a log-rank test.

Fig. S8. ABTAA protects against major organ injury and microvascular disintegration.

Fc, ABA (AB), or ABTAA (AT) (10 mg/kg) was administered to mice at 6 hours after CLP. Kidneys and thoracic aorta were harvested 24 hours

after CLP. (A-D) Representative images and comparisons of tubular injuries and peritubular capillary rarefaction in kidney and en-face view of VE-

cadherin in ECs of the thoracic aorta. The junctional density is calculated by VE-cadherin+ area in a random 0.022 mm2 region of the thoracic aorta.

Scale bars, 20 m. Bars indicate mean ± SEM (n = 4-5). *P < 0.05 versus Fc; #P < 0.05 versus AB. Sh, sham.

Fig. S9. Pretreatment with ABA or ABTAA mitigates parenchymal injuries and microvascular disintegration.

Fc, ABA (AB), or ABTAA (AT) (10 mg/kg) was administered to mice 1 hour before CLP. Lungs, kidneys, and thoracic aorta were harvested 24

hours after CLP. (A-F) Representative images and comparisons of tissue injuries, NG2+ pericyte coverage of ECs, and CD31+ peri-tubular capillary

density in the lung and renal cortex, and en-face view of VE-cadherin in ECs of the thoracic aorta. Pericyte coverage is presented as relative % of

NG2+ area per CD31+ area (Sh is regarded as 100%), whereas the junctional density is calculated as VE-cadherin+ area in a random 0.022 mm2

region of the thoracic aorta. Scale bars, 20 μm. Bars indicate mean ± SEM (n = 4-5). *P < 0.05 versus Fc; #P < 0.05 versus AB. Sh, Sham.

Fig. S10. Intravital microscopy was used to measure the pulmonary endothelial glycocalyx.

(A) The imaging window is connected with a suction tube to stabilize the lungs during image acquisition. (B,C) Images and quantification of

endothelial surface layer (ESL) thickness (yellow solid bar) determined by subtracting the width of the RBC track (inner dotted line) from the

capillary diameter (outer dotted line) of sham and septic mice. At 24 hours after CLP, FITC-dextran (MW 40 kDa) was intravenously injected, and

intravital fluorescence images were acquired using a custom-built confocal microscope. Scale bars, 10 μm. The 10 most uninterrupted random

images from each mouse in each group (n = 5) were analyzed in a blind manner. Bars indicate means ± SEM of the actual values. **P < 0.01

determined by unpaired Student’s t test.

Fig. S11. ABTAA reduces pulmonary vascular leakage.

Fc, ABA (AB), or ABTAA (AT) (10 mg/kg) was given to septic mice 6 hours after CLP, and lungs were harvested 24 hours after

CLP. FITC-conjugated dextran (MW, 40 kDa) was intravenously injected 30 min before sacrifice. Representative images (A) and

quantification (B) of dextran leakage area (green) from pulmonary micro-vasculature are shown. The FITC-dextran+ areas were

divided by CD31+ area and normalized to that of Sham (Sh). Bars indicate means ± SEM (n = 6). *P < 0.05 versus Fc; #P < 0.05

versus AB.

Fig. S12. Pretreatment with ABTAA blunts the cytokine storm in sepsis.

Fc, ABA (AB), or ABTAA (AT) (10 mg/kg) was administered to mice 1 hour before CLP. (A,B) Temporal changes in serum

concentrations of TNF-α and IL-6 after CLP. Each group, n = 6-8. Dots indicate mean ± SEM. *P < 0.05 versus Fc; #P < 0.05 versus

AB.

Fig. S13. Posttreatment with ABTAA does not attenuate cytokine storm in the primary endotoxemia model.

Fc or ABTAA (10 mg/kg) was administered to mice at 6 hours (arrows) after intraperitoneal LPS injection. (A,B) Temporal changes

in serum concentrations of TNF-α and IL-6 after LPS injection. Each group, n = 5-7. Dots indicate mean ± SEM. The P values were

determined by unpaired Student’s t test.

Fig. S14. Pretreatment with ABTAA blunts ANG2 surge in sepsis.

Fc, ABA (AB), or ABTAA (AT) (10 mg/kg) was administered to mice 1 hour before CLP, and imipenem (20 mg/kg) was

administered immediately and 12 hours after CLP. The graph shows temporal changes in serum concentrations of ANG2 after CLP.

Each group, n = 6-8. Dots indicate mean ± SEM. *P < 0.05 versus Fc; #P < 0.05 versus AB.