Synthesis and antitumor activities of novel diacerein …nopr.niscair.res.in/bitstream/123456789/30081/1/IJCB 53B... · 2016. 7. 20. · Diacerein, clinically used as in anti-inflammatory,

Indian Journal of Chemistry

Vol. 53B, December 2014, pp 1584-1595

Synthesis and antitumor activities of novel diacerein

α-aminophosphonates conjugates

Qin Jian-Mei

a, Li Jian-Fei

a, Ye Man-Yi

a, Huang Ri-Zheng

a, Xu Qing

b, Pan Ying-Ming

a,

Wang Heng-Shan*a & Yao Gui-Yang

a

aState Key Laboratory Cultivation Base for Chemistry and Molecular Engineering of Medicinal Resources,

School of Chemistry & Pharmaceutical Science of Guangxi Normal University, Guilin 541004, P. R. China

bCollege of Pharmacy, Guilin Medical University, Guilin 541004, P. R. China

E-mail: [email protected]

Received 24 December 2013; accepted (revised) 7 October 2014

Several diacerein α-aminophosphonates conjugates 4a-k have been synthesized, the structures of compounds have been

characterized by IR, 1H NMR, 13C NMR, 31P NMR, ESI-MS spectra and elementary analysis. In vitro cytotoxicity against

HepG-2, CNE, Spca-2 and Hct-116 cells are evaluated and employing standard MTT assay in comparing with commercial

anticancer drug 5-fluorouracil (5-FU). Some compounds exhibit moderate to high levels of antitumor activity. Especially,

compound 4i exhibit the strongest cytotoxicity against Hct-116 cells with IC50 9.83 µM. All the synthesized compounds

exhibit low cytotoxicity against HUVEC cells. The mechanism of compound 4i has been preliminarily investigated by

Hoechst 33258 staining, JC-1 mitochondrial membrane potential staining and flow cytometry, which indicate that the

compound 4i induced apoptosis in Hct-116 cancer cells. Cell cycle analysis show that compound 4i mainly arrested Hct-116

cells in G1 stage. The effects of 4i on the activation of caspases expression indicate that 4i might induce apoptosis via the

membrane death receptor pathways. In addition, the binding properties of a model analog 4i to DNA have been investigated

by methods (UV-Vis, fluorescence, CD spectroscopy) in comparison with that of diacerein. Results indicate that 4i show

moderate ability to interact ct-DNA.

Keywords: Diacerein, α-aminophosphonic acids, cytotoxicity, cell cycle, DNA binding

Finding new tricks for old drugs is an efficient route

for public sector drug discovery1. Many studies have

discovered many new applications of existing drugs,

such as aspirin2, metformin

3.

Diacerein, clinically used as in anti-inflammatory,

analgesic and antipyretic agent, developed

specifically for the treatment of goarthrosis and

coxarthrosis4-6

. Moreover, diacerein has also been

reported to display another biological activity,

prevention of vascular diseases and treatment of

insulin resistance7. However, the antitumor activity of

diacerein has rarely been studied. Recently, in our

laboratory, we found that diacerein had anti-

proliferative activity against some tumor cells, but

with weak cytotoxicity against normal cells,

motivating us to seek higher activity of diacerein

derivatives. In our precious work, we found that the

introduction of aminophosphonate group to pharmacy

core is able to increase the antitumor activity and

many aminophosphonates derivatives have exhibited

potent inhibition activity against human tumors8-15

.

Based on the concept of hybrid molecules16,17

with a

dual mode of action, a series of diacerein α-amino-

phosphonates conjugates were designed in our study

to find new antitumor agent.

Herein, we report (a) the synthesis of diacerein

α-aminophosphonates conjugates; (b) DNA binding of

potent conjugate 4i; (c) in vitro antitumor activity and

cell selectivity of synthesized conjugates; and (d) the

mechanism of how the novel conjugate 4i killed

Hct-116 cells Scheme I.

Results and Discussion

Chemistry All compounds were obtained as yellowish solids

after column chromatography. Their structures were

fully characterized by 1H NMR. For example, the

corresponding 1H NMR spectrum showed the two

methyleneoxy (OCH2CH3) groups attached with

phosphorus appears as three multiplets at δ 3.28-4.35.

The chemical shifts of the three methyl (OCH2CH3)

hydrogens were different due to the low rate of

environmental exchange caused by the slow rotation

JIAN-MEI et al.: DIACEREIN α-AMINOPHOSPHONATES CONJUGATES

1585

of the P-C bond. The structures of all the compounds

were further confirmed by IR, 13

C NMR, 31

P NMR,

EI-MS and elemental analysis.

In vitro antitumor activity The cytotoxicity results of all of the compounds

against HepG-2, CNE, Spca-2, and Hct-116 cell lines

are listed in Table I. As shown in Table I, the IC50

values of most of the conjugates were lower than

diacerein. Compounds 4b and 4i exhibited better

cytotoxic effects than other compounds. These results

demonstrated that large aromatic ring (e.g. 4k) will

reduce cytotoxicity, ortho-substituent and meta-

substituent had relatively little influence on cell

toxicity, while para-substituent will enhance

cytotoxicity. In Hct-116 assay, most of compounds

exhibited better inhibition than diacerein, especially

compound 4i was found to be the most active

compounds on Hct-116 cell line, with IC50 of 9.83

µM. In comparison, activities of compounds against

normal cells (HUVEC) were also examined (Table I).

The results indicated that the anti-proliferative

activity of some compounds was much higher against

cancer cells than normal cells.

DNA is generally the primary intracellular target of

anticancer drugs18,19

, so the interaction of small

molecules with DNA plays an important role in many

biological processes20

. In addition, DNA appears to be

the major cellular target for most anthraquinone-based

structures21,22

, which is generally accepted by DNA-

interactive drugs. Furthermore, anticancer drugs

targeting DNA can inhibit cell cycle progression

and/or induce apoptosis by activation of cell cycle

checkpoint in response to DNA damage23,24

. Because

compounds 4 are isostructural, and compound 4i was

selected as representative to investigate their binding

properties to DNA. To this end, two analytic methods,

UV-Vis and fluorescence spectroscopies, were

performed.

UV-Vis absorption spectral analysis

As shown in Figure 1, the absorbance of 4i changed

upon addition of DNA. This indicated that DNA is one

potential target of 4 as expected. The DNA binding

constant Kb was calculated by non-linear fitting

according to the Equations (1a), by which the values of

Kb for 4i were found to be 1.15×104 M

-.

OH OH

COOH

O

O

Rhein Diacerein

Ac2O

N

Ar

CHO

PH

NH4OAC Ar N Ar

PEtO OEt

O1) HCl

2) NaOH

EDCI, HOBt

OAc OAcO

O O

HN Ar

PO OEt

OEt

1a-1k 2a-2k 3a-3k

4a-4k

Ar

H2N P

O

OEtEtO

O O

COOH

O

O

H3C

O

CH3

O

1

2

3

45

6

7

89

1011

1213

14

15

1718

20

22

23

24

2516 19

21

O

OEtEtO

P

H2N

O

OEtEtO

1,

2,

3,

4,

5,

6,

R

P

H2N

O

OEtEtO

1,

4,

5,

6,

2,

3,

7,

8, 9,10,

4a-4i4j

P

H2N

OEtO1,

5,

6,7,

8,

9,

10,

4k

OEt 2,

3,

4,11,12,

13,

14,

Scheme I — General synthetic route for compounds 4a-k.

INDIAN J. CHEM., SEC B, DECEMBER 2014

1586

Figure 1 — UV-Vis absorption spectra of complex 4i in the

absence (---) and presence (—) of ct-DNA with increasing

[DNA]/4i ratios in the range from 1:1 to 5:1

Fluorescence emission titration The quenching ability of compound 4i to GelRed

fluorescence can be quantitively estimated by their

respective quenching constant, Kq, which were

derived from the Stern-Volmer quenching equation

(Figure 2). The Kq value for 4i was 3.86 × 103,

exhibiting similar intensive intercalation to DNA as

diacerein (1.02 × 104). Meanwhile, it can also be

confirmed that the intercalative binding mode of 4i to

DNA was similar to GelRed.

CD spectra analysis The circular dichroism (CD) is a useful technique

to assess whether the nucleic acids undergo conformational

Figure 2 — Fluorescence emission spectra of GelRed bound with

ct-DNA ([DNA] = 2.0 × 10-4 M, [GelRed]=2.0 × 10-5 M) in the

absence (dash line) and presence (solid lines) of 4i with

4i/[GelRed] ratios ranging from 1:1 to 8:1. Inset: linear fitting for

quenching constant Kq based on Stern-Volmer equation

changes as a result of complex formation or changes

in environmental conditions27

. As indicated in Figure 3,

the CD spectra of ct-DNA (1.5 × 10-4

M) showed a

positive absorption peak at 279 nm and a negative

absorption peak at 248 nm due to π-π base stacking

and right-hand helicity, respectively. This was

consistent with the characteristic B conformation of

DNA28

. Upon the addition of 4i at a [4i]/[DNA] ratio

of 1:10, the CD absorption of ct-DNA showed an

obvious decrease in the intensities of both the

Table I — IC50a values (µM) of diacerein and derivatives 4a-k towards four selected tumor cell lines and normal cell lines for 48 hr

IC50(µM)

Compd Ar HepG-2 CNE Spca-2 Hct-116 HUVEC

4a o-Ph-F 54.01±2.34 89.35±2.34 >100 78.32±2.34 >100

4b p-Ph-F 13.65±1.05 18.45±2.04 19.35±1.50 11.53±1.99 >100

4c o-Ph-Cl 40.46±3.34 64.44±3.44 >100 87.32±9.63 >100

4d p-Ph-Cl 32.31±2.58 25.69±2.36 30.21±2.68 28.07±2.55 >100

4e m-Ph-Br 55.90±3.37 24.43±2.56 >100 98.32±8.34 >100

4f p-Ph-Br 28.96±1.54 58.76±3.04 40.25±2.99 35.98±2.86 >100

4g o-Ph-OCH3 81.93±3.84 >100 55.69±3.58 51.55±3..38 >100

4h p-Ph-OCH3 56.86±2.68 37.07±2.8 25.32±1.34 16.31±1.38 >100

4i p-Ph-CH3 22.93±1.34 19.19±0.89 11.38±1.03 9.83±0.68 >100

4j 1-Naphthalene 19.68±2.01 23.58±1.32 30.20±2.34 19.00±1.82 >100

4k Anthracene >100 >100 >100 99.36±8.59 >100

diacerein 58.34 >100 38.31±1.40 58.21±2.18 >100

5-Fu 20.30±2.43 >50 No Date 4.3±0.52 No Date

aIC50 values are presented as the mean ± SD (standard error of the mean) from three independent experiments.


1587

negative and positive absorption bands. The decrease

in the intensities of both positive and negative bands

can usually be observed in the intercalative binding of

small molecules to DNA.

Hoechst 33258 staining

Hoechst 33258 is a membrane permeable dye with

blue fluorescence. Live cells with uniformly light blue

nuclei were obviously detected under fluorescence

microscope after treatment with Hoechst 33258,

whereas apoptotic cells had bright blue nuclei due to

Figure 3 — CD spectra of ct-DNA (2 mL solution, 1.5 × 10-4 M)

in the absence and presence of 4i (1.5 × 10-5 M)

karyopyknosis and chromatin condensation. On the

contrary, the nuclei of dead cells could not be stained.

Hct-116 cells which were treated with compound 4i

for 24 hr at different concentrations were stained with

Hoechst 33258. Hct-116 cells not treated with 4i were

used as control at for 24 hr. The results were given in

Figure 4. As shown in Figure 4, cells not treated with

compound 4i were normally blue. It was worth noting

that, for 4i treatment, the cells displayed strong blue

fluorescence and indicated typical apoptotic

morphology at 10 µM and 15 µM. The observation

revealed that compound 4i induced apoptosis against

Hct-116 cells.

Mitochondrial membrane potential staining

Mitochondrial membrane potential changes were

also designed and detected to further investigate the

apoptosis-inducing effect of target compound 4i,

employing a fluorescent probe JC-1. JC-1 is a

lipophilic cationic dye and it can easily pass through

the plasma membrane into cells and accumulate in

actively respiring mitochondria. Hct-116 cells treated

with 4i for 24 hr at different concentrations were

stained with JC-1 and not treated with 4i were used as

control. The results were shown in Figure 5. The JC-1

monomer and J-aggregates were excited at 514 nm

Control (-) 4i: 10 µM 4i: 15 µM

Figure 4 — Hoechst 33258 staining of compound 4i in Hct-116 cells


Figure 5 — JC-1 mitochondrial membrane potential staining of compound 4i in Hct-116 cells


1588

and 585 nm, respectively, and light emissions were

collected at 515-545 nm (green) and 570-600 nm

(red). For fluorescence microscopy, the results

displayed that cells not treated with the compounds

were normally red (in the web version), while for 4i

treatment, cells exhibited strong green fluorescence

and indicated typical apoptotic morphology.

Therefore, it could be concluded that compound 4i

induced apoptosis against Hct-116 cell line. The

results were identical with that of previous experiment

of Hoechst 33258 staining.

Apoptosis analysis It was reported that many anthraquinones (rhein

and emodin) killed the cancer cells through apoptotic

mechanisms. In the present study, the apoptotic cell

rates were determined for the Hct-116 cells after

stimulation for 24 hr by the compound 4i at different

concentrations. The graphical values of the results

were given in Figure 6. From the results, it was found

that this compound stimulated apoptosis for Hct-116

cells compared to negative (unstimulated cells by

compounds) controls. The results showed that the

apoptosis ratios of compound 4i measured different

concentration points were found to be 25.6% (10µM),

36.2% (15µM), respectively, while that of control was

2.9%. The results were identical with that of the

previous experiments (Hoechst 33258 staining and

JC-1).

Cell cycle analysis The cell cycle is the series of events that take place

in a cell leading to its division and duplication

(replication). The cell cycle consists of four distinct

phases: G1 phase, S phase (synthesis), G2 phase

(collectively known as interphase) and M phase

(mitosis). The G1 stage is the stage when preparation

of energy and material for DNA replication occurs.

The S stage is the stage when DNA replication

occurs. The G2 stage is the stage when preparation for

the M stage occurs. The M stage is “mitosis”, and is

when nuclear and cytoplasmic division occurs. To

determine whether the suppression of cancer cell

growth by compound 4i was caused a cell-cycle

arrest. The Hct-116 cells were treated with compound

4i at different concentrations, resulting in concomitant

population increase in the G1 phase (46.74% and

55.28%) compared with the control cells (43.39%)

and the population of the G2 phase decrease at a

certain extent (10.08% and 7.03%) compared with the

control cells (17.47%) (Figure 7). These results

suggested that the G1 stage was stopped, the

preparation of energy and material for DNA

replication could not occur, and the S stage was

stopped, the DNA replication was blocked.

Fluorogenic quantitative PCR analysis

Apoptosis can be triggered by several stimuli and is

controlled by two major pathways, namely the

mitochondrial pathway and membrane death receptor

pathway. The membrane death receptor pathway is

characterized by the binding between cell death

ligands and cell death receptors and the subsequent

activation of caspase-8 and caspase-3. The diacerein

α-aminophosphonate derivatives induced apoptotic

pathway was investigated by qRT-PCR analysis of

caspase expressions. As showed in Figure 8,

compound 4i treatment showed concentration-

dependent effects in caspases-3 and caspases-8, and

these effects were concentration-dependent.


Figure 6 — Effect of compound 4i on apoptosis of Hct-116 cells. Apoptotic cells were analyzed by flow cytometry, after being stained

with Annexin V-FITC together with PI. The percentage of cells positive for PI and/or Annexin V-FITC is reported inside the quadrants


1589

Figure 8 — 4i affected the activities of caspase-4,-9,-8, and-3 of

Hct-116 cells

Therefore, we preliminarily concluded that 4i induced

the apoptosis of Hct-116 cells via the membrane death

receptor pathways.

Conclusion

A series of diacerein α-aminophosphonate

conjugates were synthesized and the cytotoxicity of

the derivatives on four cancer cell lines were

determined. It was detected that the compound 4i had

selective and significant cytotoxic effects on Hct-116

cells, but low cytotoxicity towards normal human cell

HUVEC. The apoptosis-inducing activity of

representative compound 4i in Hct-116 cells was

studied and the results revealed that this compound

showed clear cell apoptosis inducing effects. In

addition, it was found that 4i arrested in G1 phase of

the cell cycle. The effects of 4i on the activation of

caspases expression indicated that 4i might induce

apoptosis via the membrane death receptor pathways.

The binding properties of 4i to DNA examined by

various methods indicated 4i interacted with DNA.

Therefore, these compounds may be considered as

agents with high potential anti-cancer activity and

good candidates for more advanced screening.

Materials and Methods All chemicals (reagent grade) used were

commercially available. NMR spectra were measured

on a BRUKER AVANCE AV500 spectrometer using

TMS as the internal standard. The mass spectra were

obtained on a BRUKER ESQUIRE HCT

spectrometer. Melting points were determined using a

X-4 apparatus and were uncorrected. Elemental

analyses were performed on a Vario Micro Cube

Elemental instrument and were within 0.4% of the

theoretical values.

All the chemical reagents including the lanthanide

salts and the solvents were analytical grade. GelRed

was purchased as nucleic acid stains from Biotium.

Calf thymus DNA (ct-DNA) was purchased from

Sigma-Aldrich. They were all used as received

without further purification unless noted specifically.

Synthesis of diacerein

To a stirred solution of rhein (113 mg, 0.4 mmol)

in pyridine (10 mL) was added acetic anhydride (0.38

mL, 4.0 mmol). The mixture was stirred at 20°C for 8

hr. After dilution with ethyl acetate (20 mL), the

mixture was washed with aqueous 1 M HCl (10 mL ×

5) and saturated NaHCO3 (10 mL × 2) and saturated

NaCl solution (10 mL). The organic phase was dried

over anhydrous sodium sulfate, filtration and

evaporation of solvent at reduced pressure, which was

purified by column chromatography on silica gel with

Control (-) 4i:10 µM 4i:15 µM

Figure 7 — Fluorescence-activated cell sorting analyses based on DNA content of Hct-116 cells treated with 4i for 48 h and stained by

propidium iodide


1590

petroleum ether/ethyl acetate (4:1, V:V) to give the

pale yellow solids. Yield 88.5%, yellow solid. m.p.

217~219°C; IR (KBr): 2980 (OH), 1770, 1765 (C=O

stretch in ester), 1701, 1680 cm-1

(C=O streching

vibrations in α,β-unsaturated ketones); 1H NMR (500

MHz, DMSO-d6): δ 2.38 (s, 3H, H-22), 2.39 (s, 3H,

H-25) 7.62 (d, J = 6.0 Hz, 1H, H-6), 7. 93 (t, J = 6.0

Hz, 1H, H-7), 8.01 (d, J = 3.0 Hz, 1H, H-3), 8.12 (d, J

= 6.0 Hz, 1H, H-8), 8.52 ( d, J = 3.0 Hz, 1H, H-1); 13

C

NMR (125 MHz, DMSO-d6): δ 21.0

(C-25), 21.1 (C-22), 123.8 (C-1), 125.3 (C-8), 126.5

(C-14), 129.4 (C-12), 129.7 (C-7), 130.4 (C-6), 134.3

(C-9), 134.8 (C-11), 135.8 (C-3), 136.7 (C-2), 149.8

(C-5), 150.0 (C-4), 165.3 (C-18), 169.3 (C-20), 169.4

(C-23), 180.5 (C-13), 181.1 (C-10); ESI-MS: m/z

369.56 (M + H)+.

Synthesis of α-aminophosphonate

A suspension of aromatic aldehydes (10 mmol) and

ammonium acetate (11 mmol) was stirred for 6 hr at

reflux. The reaction mixture was filtered to give the

white precipitate 2, Diethyl phosphite (5 mmol) was

added to 2 and the resulting solution was stirred for

6 hr at 80°C. After cooling to RT, hydrochloric acid

(4 mmol) was added to the reaction mixture at 0°C,

which was stirred for 2 hr to give the precipitate 3.

The precipitate was filtered and washed with ether

(3 × 15 mL), and then it was added to sodium

hydroxide solution (10%) in water phase to pH 8 and

stirred for 30 min at RT. After extraction with ethyl

acetate (3 × 25 mL), the organic phase was dried over

anhydrous sodium sulfate, the solvent was removed

by evaporation under reduced pressure, gave the oils

of 3, which was purified by column chromatography

on silica gel with petroleum ether/ethyl acetate

(1:2, V:V).

General synthesis of target compounds 4a-k

Diacerin (1 mmol) and HOBt (0.2 mmol) in DMSO

(15 mL) were treated with EDCI (1.2 mmol) and

stirred for 15 min at 0°C. Then 3 was added dropwise

with constant stirring at 0°C, the mixture was

stirred for another 10 hr at RT, then washed

with brine, the organic phase was dried with

anhydrous sodium sulfate, filtered and dried at under

vacuum. The residue was purified by column

chromatography on silica gel with petroleum

ether/ethyl acetate (3:1, V:V), 4a-k were obtained as a

pale yellowish solid.

Cytotoxicity of diacerein derivatives Cell Lines. The following in vitro human cancer

cell lines were used: HepG 2 (Human epidermoid

larynx carcinoma), Hct-116 (Human colorectal cells),

CNE (human nasopharyngeal carcinoma cells), Spca-

2 (human lung adenocarcinoma cell line), HUVEC

(Human Umbilical Vein Endothelial Cells). The cell

lines (HepG 2, Hct-116, CNE, Spca-2) were

purchased from the Cell Resource Center of Shanghai

Institutes for Biological Sciences, the Academy of

Sciences of China.

Cell Culture. HepG 2, Hct-116, CNE and HUVEC

cells were cultured in Dulbecco Modified Eagle

Medium (DMEM; HyClone, USA), containing

4.0 mM L-Glutamine and 4500 mg/L Glucose,

supplemented with 10% (v/v) foetalbovine serum

(FBS; HyClone, USA). Spca-2 was cultured in

RPMI-1640 medium (HyClone, USA), containing

2.05Mm L-Glutamine without Calcium nitrate,

supplemented with 10% (v/v) foetalbovine serum

(FBS; HyClone, USA). The cell culturemedia was

supplemented with penicillin/streptomycin at

100 Units/mL as adherent monolayers. Cell cultures

were kept in a humidified incubator with 5% CO2 at

37°C. Stock solutions were prepared in dimethyl

sulfoxide (DMSO) and further dilutions were made

with fresh culture medium. The concentration of

DMSO in the final culture medium was 1%, which

had no effect on the cell viability.

MTT assay. Chemosensitivity was assessed using

3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium

bromide (MTT) assay. Briefly, exponentially growing

HepG 2 cells (2000-3000 cells/well), Hct-116

(3000-4000 cells/well), CNE (2000-3000 cells/well),

HUVEC (2000-3000 cells/well) and Spca-2

(2000-3000 cells/well) were seeded into 96-well

plates and treated with indicated concentrations of

samples for 48hr, and then 10 mL of MTT

(10mg/mL) was added. After incubation for 4 hr at

37°C, the purple formazan crystals (i.e. a reduced

form of MTT) generated from viable cells were

dissolved by adding 100 µL DMSO in each well. The

plates were swirled gently for 10 min to dissolve the

precipitate, and quantified by measuring the optical

density (OD) of the plates at a wavelength of 490 nm

on plate reader (TECAN infinite M1000). Each

concentration was repeated in three wells and the

same experimental conditions were provided for all

compounds and MTT analysis was repeated three

times for each cell line.


1591

Hoechst 333258 staining Cells grown on a sterile cover slip in six-well tissue

culture plates were treated with compounds for a

certain range of time. The culture medium containing

compounds was removed, and the cells were fixed in

4% paraformaldehyde for 10 min. After being washed

twice with PBS, the cells were stained with 0.5 mL of

Hoechst 33258 (Beyotime) for 5 min and then again

washed twice with PBS. The stained nuclei were

observed under a Nikon ECLIPSETE2000-S

fluorescence microscope using 350 nm excitation and

460 nm emissions.

Mitochondrial membrane potential staining JC-1 probe was employed to measure

mitochondrial depolarization in Hct-116 cells. Briefly,

Cells cultured in six-well plates after indicated

treatments were incubated with an equal volume of

JC-1 staining solution (5 µg/mL) at 37°C for 20 min

and rinsed twice with PBS. Mitochondrial membrane

potentials were monitored by determining the relative

amounts of dual emissions from mitochondrial JC-1

monomers or aggregates using a Nikon

ECLIPSETE2000-S fluorescent microscope.

Mitochondrial depolarization is indicated by an

increase in the green/red fluorescence intensity ratio.

Apoptosis analysis

Apoptosis was discriminated with the annexin

V-FITC/propidium iodide test. Cells were seeded at

2 × 106/well in 10% FBS-DMEM into 6-well plates,

and treated with compounds for 24 hr. The cells were

washed twice with cold Phosphate Buffered Saline

(PBS) and then resuspend cells in 1 × Binding Buffer

(0.1 M Hepes/NaOH (pH 7.4), 1.4 M NaCl, 25 mM

CaCl2)) at a concentration of 1 × 106 cells/mL.

Transfer 100 µL of the solution (1 × 105

cells) to a

5 mL culture tube, and add 5 µL of FITC Annexin V

(BD, Pharmingen) and 5 µL propidium iodide (PI) to

each tube. Gently vortex the cells and incubate for

30 min at RT (25°C) in the dark. Add 200 µL PBS to

each tube. Analysis was performed with the system

software (CellQuest; BD Biosciences). Lower left

quadrant, viable cells (annexin V-/PI-); lower right

quadrant, early apoptotic cells (annexin V+/PI-);

upper right quadrant, late apoptotic cells

(annexin V+/PI+); upper left quadrant, necrotic cells

(annexin V-/PI+). The percentage of cells positive for

PI and/or Annexin V-FITC was reported inside the

quadrants.

Cell cycle analysis The cells lines were treated with indicated

concentrations of compound 4i. After incubation for

48 hr, cells were washed twice with ice-cold PBS,

fixed and permeabilized with ice-cold 70% ethanol at

-20°C overnight. The cells were treated with

100 µg/mL RNase A at 37°C for 30 min after washed

with ice-cold PBS, and finally stained with 1 mg/mL

propidium iodide (PI) in the dark at 4°C for 30 min.

Analysis was performed with the system

software(CellQuest; BD Biosciences).

Real-Time PCR of Caspase-3,-4,-8 and-9

Total RNA was extracted from the Hct-116 cells

after treatment with 5 µM, 10 µM, 20 µM diacerein

α-aminophosphonate derivatives for 24 hr using the

Qiagen RNeasy Mini Kit as described previously.

RNA samples were reverse-transcribed for 30 min at

42°C with the High Capacity cDNA Reverse

Transcription Kit (Applied Biosystems). The SYBR®

Green PCR Master Mix (ABI, USA) and specific

primer pairs were used for selected genes, and the

primer pair for actin was used as the reference gene.

qPCRwas performed according to the following

conditions: 2 min at 50°C, 10 min at 95°C, and 40

cycles of 15 s at 95°C and 1 min at 60°C using 0.5 µL

of complementary (c)DNA, 2 × SYBR Green PCR

Master Mix, and 500 nM of the forward and reverse

primers: CASP3-F81, GAGTGCTCGCAGCTCATACCT;

CASP3-R, CCTCACGGCCTGGGATTT; CASP4-

F91, GAAACTCCAAGGGCCAAAGC; CASP4-R,

TCCATTTTCAATTGCCAGGAA; CASP8-F119,

CTTTATGATATTGGGGAACAAC; CASP8-R,

TGGAATAACATCAAGGCATC; CASP9-F247,

CATTGGTTCTGGAGGATTTG; CASP9-R,

CATTTTCTTGGCAGTCAGGT. The threshold cycle

number (Ct) was calculated with ABI software.

Relative transcript quantities were calculated using

the △Ct method with actin as the reference gene

ampli △fied from the same samples. Ct is the

difference in the threshold cycles of messenger

(m)RNA for selected genes relative to those of actin

mRNA. The real-time RT-PCR was performed in

triplicate for each experimental group.

Spectroscopic studies on DNA interaction

The 2 × 10-3

M ct-DNA stock solution was stored

at 4°C for no more than 5 days before use. The

synthesized conjugate (4b and 4i) was prepared as

2 × 10-3

M DMSO stock solutions for DNA binding


1592

studies. The final working solutions of the complexes

for DNA binding studies were diluted by TBS and the

DMSO content was less than10%. For UV-vis

absorption experiments, the working solution of the

complexes was constantly kept at 25 µM. The ct-

DNA stock solution was increasingly added until a

saturation state was achieved. After each addition, the

solution was allowed to incubate for 5 min before the

absorption spectra were recorded. Kb as the

equilibrium DNA binding constant and s as the

binding site size were determined by non-linear fitting

according to the following equation27,28

:

Ct[DNA]/(εa−εf)=Ct[DNA]/(εb−εf)+1/Kb(εb−εf) (1a)

where Ct [DNA] is the DNA concentration in

nucleotides, εa is the molar extinction coefficient of

the compound bound with DNA, εf is the extinction

coefficient of the free compound, and εb is the

extinction coefficient of the compound fully bound to

DNA.

A solution containing 2 × 10-4

M DNA and 2 × 10-5

M GelRed ([DNA]/[GelRed] = 10:1) was prepared for

GelRed-DNA competitive binding studies. Fluo-

rescence emission spectra were recorded under slit

width as 10 nm/10 nm for Ex/Em, respectively. The

quenching constant for comparing the efficiency of

fluorescence quenching, i.e., Kq, of each compound

was obtained by the linear fit of plotting I0/I versus

[Q], according to the classic Stern–Volmer equation:

I0/I = 1+Kq×[Q] (Ref 29), where I0 and I are the peak

emission intensity of the GelRed-DNA system in the

absence and presence of each compound as quencher,

and [Q] is the concentration of quencher. In the

fluorescence polarization experiment, each sample

was pre-incubated for 40 min before the fluorescence

polarization was recorded under the condition of 595

nm emitting wavelength with 350 nm exciting

wavelength, and slit width was set as 5 nm/5 nm for

Ex/Em, respectively.

CD absorption spectra of DNA were measured in

TBS at a 100 nm/min scan rate in the wavelength

range from 200 to 500 nm, with 1.5 × 10-4

M DNA in

the absence and presence of each compound of

1.5 × 10-5

M, respectively. The CD signal of TBS was

taken as the background and subtracted from the

spectra. All the spectroscopic experiments were

performed at 25°C.

Statistical analysis All statistical analyses were performed with

SPSS10. Data were analyzed by one-way analysis of

variance (ANOVA). Mean separations were

performed using the least significant difference

method (LSD test). Each experiment had three

replicates and all experiments were run three times

with similar results. Measurements from all the

replicates were combined and treatment effects

analyzed.

Spectral data

8-(Acetyloxy)-3-({[(diethoxyphosphoryl)(2-fluoro-

phenyl)methyl]amino}carbonyl)-9,10-dioxo-9,10-

dihydro-1-anthracenyl acetate, 4a: Yield 80%. Pale

yellow solid. m.p. 162~164°C. IR (KBr): 1770, 1765

(C=O stretch in ester), 1701, 1680 (C=O stretching

vibrations in α,β-unsaturated ketones), 1550 (NH),

1330 cm-1

(C-N); 1H NMR (500 MHz, CDCl3): δ 8.66

(d, J = 1.8 Hz, 1H, Ar-H), 8.43 (dd,

J = 9.4, 4.3 Hz, 1H, Ar-H), 8.20 (dd, J = 7.8, 1.3 Hz,

1H, Ar-H), 7.94 (d, J = 7.8 Hz, 1H, Ar-H), 7.77 (t, J = 7.9

Hz, 1H, Ar-H), 7.57 (ddd, J = 8.7, 5.1, 1.9 Hz, 2H,

Ar-H), 7.42 (d, J = 8.0 Hz, 1H, NH), 7.05 (d, J = 8.5 Hz,

2H, Ar-H), 5.75 (dd, J = 21.4, 9.3 Hz, 1H, P-CH),

4.20-4.11 (m, 2H, OCH2), 3.98-3.84 (m, 2H, OCH2),

2.44 (s, 3H), 2.43 (s, 3H), 1.31 (t, J = 7.1 Hz, 3H,

CH3), 1.12 (t, J = 7.0 Hz, 3H, CH3); 13

C NMR (125 MHz,

CDCl3): δ 181.4 (C-10), 180.3 (C-13), 169.2 (C-23),

169.0 (C-20), 164.5 (C-18), 160.3 (C-2′), 150.3 (C-4),

150.1 (C-5), 139.3 (C-2), 134.8 (C-3), 134.6 (C-11),

134.4 (C-9), 130.4 (C-6), 130.0 (C-7), 129.8 (C-1′),

129.7 (C-12), 128.7 (C-6′), 128.2 (C-4′), 126.5 (C-14),

125.4 (C-8), 124.3 (C-1), 123.8 (C-5′), 115.3 (C-3′),

48.8 (-OCH2), 47.7 (-OCH2), 66.6 (-PCH, d, J = 3.6 Hz),

21.8 (C-22), 20.8 (C-25), 16.3 (-CH3), 16.1 (-CH3); 31

P

NMR(200 MHz, CDCl3): δ 20.97; ESI-MS: m/z

612.18 (M + H)+. Anal Calcd for C30H27FNO10P: C,

58.92; H, 4.45; N, 2.29; Found: C, 58.95; H, 4.43; N,

2.31%.

8-(Acetyloxy)-3-({[(diethoxyphosphoryl)(4-fluoro-

phenyl)methyl]amino}carbonyl)-9,10-dioxo-9,10- dihydro-1-anthracenyl acetate, 4b: Yield 79%. Pale




1319 cm-1

(C-N); 1H NMR (500 MHz, CDCl3): δ 1.11

(t, J = 7.1 Hz, 3H, CH3), 1.29 (t, J = 7.1 Hz, 3H, CH3),

2.42 (s, 3H), 2.43 (s, 3H), 4.00–3.83 (m, 2H, OCH2),

4.19–4.10 (m, 2H, OCH2), 5.76 (dd,


1593

J = 21.3, 9.3 Hz, 1H, P-CH), 7.03 (t, J = 8.6 Hz, 2H,

Ar-H), 7.41 (d, J = 8.1, 1.0 Hz, 1H, NH), 7.64-7.49

(m, 2H, Ar-H), 7.76 (t, J = 7.9 Hz, 1H, Ar-H), 7.91 (d,

J = 7.7 Hz, 1H, Ar-H), 8.18 (dd, J = 7.7 Hz, 1H, Ar-H),

8.41 (d, J = 6.1 Hz, 1H, Ar-H), 8.62 (d, J = 1.7 Hz,

1H, Ar-H); 13

C NMR (125 MHz, CDCl3): δ 181.5 (C-10),

180.0 (C-13), 169.2 (C-23), 169.1 (C-20), 164.6 (C-18),

160.3 (C-4′), 150.3 (C-4), 150.1 (C-5), 144.7 (C-1′),

139.3 (C-2), 138.3 (C-1), 134.8 (C-3), 134.7 (C-11),

134.4 (C-9), 130.5 (C-6), 130.3 (C-7), 129.8 (C-12),

128.9 (C-6′), 128.8 (C-2′), 126.1 (C-14), 125.3 (C-8),

115.5 (C-6′), 115.4 (C-5′), 50.2 (-OCH2), 49.5 (-OCH2),

63.1 (-PCH, d, J = 3.4 Hz), 22.0 (C-22), 20.4 (C-25),

16.5 (-CH3), 16.3 (-CH3); 31

P NMR (200 MHz, CDCl3):

δ 20.61 20.59; ESI-MS: m/z 612.20 (M + H)+. Anal

Calcd for C30H27FNO10P: C, 58.92; H, 4.45; N, 2.29.

Found: C, 58.94; H, 4.44; N, 2.32%.

A-(acetyloxy)-3-({[( 2-chlorophenyl)(diethoxyphos-

phoryl)methyl]amino}carbonyl)-9, 10-dioxo-9,10- dihydro-1-anthracenyl acetate, 4c: Yield 80%. Pale




1335 cm-1

(C-N); 1H NMR (500 MHz, CDCl3): δ 8.64

(d, J = 7.8 Hz, 1H, Ar-H), 8.23 (dd, J = 7.8, 1.2 Hz,

1H, Ar-H), 7.92 (d, J = 7.8 Hz, 2H, Ar-H), 7.79 (t, J = 7.9

Hz, 1H, Ar-H), 7.71 (d, J = 7.6 Hz, 1H, NH), 7.46-7.39

(m, 2H, Ar-H), 7.32-7.26 (m, 3H, Ar-H), 6.29 (dd,

J = 21.5, 8.9 Hz, 1H, Ar-H), 4.27–4.18 (m, 2H,

OCH2), 3.98-3.83 (m, 2H, OCH2), 2.45 (s, 6H), 1.36

(t, J = 7.1 Hz, 3H, CH3), 1.10 (t, J = 7.1 Hz, 3H,

CH3); 13

C NMR (125 MHz, CDCl3): δ 181.2 (C-10),

180.2 (C-13), 169.2 (C-23), 169.1 (C-20), 164.4 (C-18),

150.2 (C-4), 150.1 (C-5), 142.5 (C-1′), 139.4 (C-2),

134.9 (C-3), 134.6 (C-11), 134.3 (C-9), 132.6 (C-2′),

130.5 (C-6), 129.8 (C-7), 129.5 (C-12), 128.7 (C-3′),

128.4 (C-6′), 128.0 (C-4′), 126.8 (C-5′), 126.5 (C-14),

125.5 (C-8), 124.3 (C-1), 53.7 (-OCH2), 50.8 (-OCH2),

64.1 (-PCH, d, J = 3.0 Hz), 21.9 (C-22), 20.8 (C-25),

16.4 (-CH3), 16.3 (-CH3); 31

P NMR (200 MHz,

CDCl3): δ 21.92; ESI-MS: m/z 628.18 (M + H)+. Anal

Calcd for C30H27ClNO10P: C, 57.38; H, 4.33; N, 2.23.

Found: C, 57.40; H, 4.32; N, 2.22%.

8-(Acetyloxy)-3-({[(4-chlorophenyl) (diethoxyphos-

phoryl)methyl]amino}carbonyl)-9,10-dioxo-9, 10-

dihydro-1-anthracenyl acetate, 4d: Yield 80%. Pale




1321 cm-1

(C-N); 1H NMR (500 MHz CDCl3): δ 1.16

(t, J = 7.0 Hz, 3H, CH3), 1.32 (t, J = 7.1 Hz, 3H,

CH3), 2.43 (s, 3H), 2.45 (s, 3H), 3.82-4.21 (m, 4H,

OCH2), 5.76 (dd, J = 22.4, 9.3Hz 1H, PCH), 7.28-8.40

(m, 9H, Ar-H, 1H, NH); 13

C NMR (125 MHz, CDCl3):

δ 181.4 (C-10), 180.2 (C-13), 169.3 (C-23), 169.2 (C-20),

164.3 (C-18), 150.3 (C-4), 150.1 (C-5), 137.0 (C-1′),

139.4 (C-2), 134.9 (C-3), 134.8 (C-11), 134.3 (C-9),

133.5 (C-4′), 130.6 (C-6), 129.7 (C-7), 129.5 (C-12),

129.2 (C-5′), 129.0 (C-3′), 128.6 (C-2′), 128.5 (C-6′),

126.4 (C-14), 125.5 (C-8), 124.4 (C-1), 51.8 (-OCH2),

49.5 (-OCH2), 63.2 (-PCH, d, J = 3.5Hz), 21.9 (C-22),

20.8 (C-25), 16.4 (-CH3), 16.3 (-CH3); 31

P NMR

(200 MHz, CDCl3): δ 21.34; ESI-MS: m/z 628.20 (M +

H)+. Anal Calcd for C30H27ClNO10P: C, 57.38;

H, 4.33; N, 2.23. Found: C, 55.78; H, 4.52; N, 2.17%.

8-(Acetyloxy)-3-({[(2-bromophenyl)(diethoxyphos-

phoryl)methyl]amino}carbonyl)-9,10-dioxo-9,10- dihydro-1-anthracenyl acetate, 4e: Yield 79%. Pale




1310 cm-1

(C-N); 1H NMR (500 MHz CDCl3): δ 1.09

(t, J = 7.1 Hz, 3H, CH3), 1.35 (t, J = 7.2 Hz, 3H,

CH3), 2.43 (s, 3H), 2.45 (s, 3H), 3.72-4.26 (m, 4H,

OCH2), 6.31(dd, J = 21.4, 9.0Hz 1H, PCH),7.17-8.22

(m, 9H, Ar-H, 1H, NH); 13

C NMR (125 MHz,

CDCl3): δ 181.3 (C-10), 180.2 (C-13), 169.2 (C-23),

169.1 (C-20), 164.5 (C-18), 150.3 (C-4), 150.1 (C-5),

145.5 (C-1′), 139.3 (C-2), 134.8 (C-3), 134.5 (C-11),

134.2 (C-9), 131.7 (C-3′), 130.4 (C-6), 129.7 (C-7),

129.5 (C-12), 129.6 (C-6′), 128.3 (C-4′), 127.2 (C-5′),

126.4 (C-14), 125.5 (C-8), 124.3 (C-1), 121.7 (C-2′),

63.7 (-PCH, d, J = 3.3 Hz), 50.7 (-OCH2), 48.5 (-OCH2),

21.8 (C-22), 20.7 (C-25), 16.4 (-CH3), 16.3 (-CH3); 31

P NMR (200 MHz, CDCl3): δ 21.33; ESI-MS: m/z

672.17 (M + H)+. Anal Calcd for C30H27BrNO10P:

C, 53.59; H, 4.05; N, 2.08; Found:C, 53.60; H, 4.07;

N, 2.07%.

8-(Acetyloxy)-3-({[(4-bromophenyl)(diethoxyphos-

phoryl)methyl]amino}carbonyl)-9,10-dioxo-9,10-

dihydro-1-anthracenyl acetate, 4f: Yield 80%. Pale

yellow solid. m.p. 212~214°C. IR (KBr):

1760, 1715 (C=O stretch in ester), 1690, 1663 (C=O

stretching vibrations in α,β-unsaturated ketones),

1515 (NH), 1312 cm-1

(C-N); 1H NMR (500 MHz,

CDCl3): δ 8.62 (d, J = 7.6 Hz, 1H), 8.23 (d, J = 7.7

Hz, 1H), 7.91 (d, J = 7.6 Hz, 2H), 7.79 (t, J = 7.8 Hz,

1H), 7.51 (d, J = 8.4 Hz, 2H),7.44 (dd, J = 7.6, 2.9

Hz, 3H), 5.67 (dd, J = 21.4, 9.3 Hz, 1H), 4.19-4.14

(m, 2H), 4.05-3.97 (m, 1H), 3.85-3.77 (m, 1H), 2.45


1594

(s, 3H), 2.45 (s, 3H), 1.32 (t, J = 7.1 Hz, 3H), 1.15 (t,

J = 7.0 Hz, 3H); 13

C NMR (125 MHz, CDCl3): δ 181.5

(C-10), 180.1 (C-13), 169.5 (C-23), 169.2 (C-20), 164.5

(C-18), 150.4 (C-4), 150.2 (C-5), 139.3 (C-2), 137.0

(C-1′), 134.8 (C-3), 134.6 (C-11), 134.1 (C-9), 131.7

(C-3′), 131.6 (C-5′), 130.3 (C-6), 129.8 (C-7), 129.4

(C-12), 129.5 (C-6′), 129.3 (C-2′), 126.4 (C-14),

125.4 (C-8), 124.3 (C-1), 121.3 (C-4′), 63.2 (-PCH, d,

J = 3.5Hz), 54.2 (-OCH2), 52.6 (-OCH2), 21.9 (C-22),

20.7 (C-25), 16.4 (-CH3), 16.3 (-CH3); 31

P NMR (200

MHz, CDCl3): δ 21.25; ESI-MS: m/z 672.19 (M +

H)+. Anal. Calcd for C30H27BrNO10P: C, 53.59; H, 4.05;

N, 2.08. Found: C, 53.61; H, 4.04; N, 2.05%.

8-(Acetyloxy)-3-({[(diethoxyphosphoryl)(2-methoxy-


dihydro-1-anthracenyl acetate, 4g: Yield 82%. Pale




1300 cm-1

(C-N); 1H NMR (500 MHz, CDCl3): δ 8.57

(d, J = 7.8 Hz, 1H), 8.22 (dd, J = 7.8, 1.2 Hz, 1H),

8.03 (d, J = 9.1 Hz, 1H), 7.92 (d, J = 7.8 Hz, 1H),

7.77 (t, J = 7.9 Hz, 1H), 7.49 (d, J = 7.6 Hz, 1H), 7.42

(dd, J = 8.0, 1.2 Hz, 1H), 7.30 (t, J = 7.9 Hz, 1H),

7.00-6.94 (m, 2H), 6.12 (dd, J = 21.0, 9.5 Hz, 1H),

4.19-4.13 (m, 2H), 4.01-3.94 (m, 1H), 3.97 (s, 3H)

3.83-3.75 (m, 1H), 2.44 (s, 6H), 1.31 (t, J = 7.1 Hz,

3H), 1.10 (t, J = 7.0 Hz, 3H); 13

C NMR (125 MHz,

CDCl3): δ 181.2 (C-10), 180.3 (C-13), 169.3 (C-23),

169.0 (C-20), 164.1 (C-18), 159.6 (C-2′), 150.3 (C-4),

150.1 (C-5), 139.6 (C-2), 134.8 (C-3), 134.5 (C-11),

134.3 (C-9), 130.4 (C-6), 129.7 (C-7), 129.4 (C-12),

128.4 (C-6′), 128.3 (C-1′), 127.3 (C-4′), 126.6 (C-14),

125.5 (C-8), 123.8 (C-1), 114.2 (C-5′), 113.6 (C-3′),

55.4 (-OCH3), 63.3 (-PCH, d, J = 3.1 Hz), 47.1 (-OCH2),

45.5 (-OCH2), 21.0 (C-22), 20.9 (C-25), 16.4 (-CH3),

16.1 (-CH3); 31

P NMR (200 MHz, CDCl3): δ 20.70;

ESI-MS: m/z 624.22 (M + H)+. Anal Calcd for

C31H30NO11P: C, 59.71; H, 4.85; N, 2.25. Found: C,

59.74; H, 4.93; N, 2.28%.

8-(Acetyloxy)-3-({[(diethoxyphosphoryl)(4-methoxy-


dihydro-1-anthracenyl acetate, 4h: Yield 80%. Pale




1315 cm-1

(C-N); 1H NMR (500 MHz CDCl3): δ 1.13

(t, J = 6.6 Hz, 3H, CH3), 1.31 (t, J = 6.6 Hz, 3H,

CH3), 3.76 (s, 3H, OCH3), 2.46 (s, 3H), 2.47 (s, 3H),

3.80-4.18 (m, 4H, OCH2), 5.75 (dd, J = 21.7, 7.6Hz

1H, PCH), 6.83-8.26 (m, 9H, Ar-H, 1H, NH); 13

C NMR

(125 MHz, CDCl3): δ 181.2 (C-10), 180.2 (C-13),

169.2 (C-23), 169.0 (C-20), 164.1 (C-18), 160.0 (C-4′),

150.2 (C-4), 150.1 (C-5), 139.6 (C-2), 134.8 (C-3),

134.4 (C-11), 134.3 (C-9), 130.6 (C-6), 129.7 (C-7),

129.4 (C-12), 128.4 (C-2′), 128.4 (C-6′), 127.5 (C-1′),

126.5 (C-14), 125.5 (C-8), 124.3 (C-1), 113.7 (C-5′),

113.5 (C-3′), 63.4 (-PCH, d, J = 3.1 Hz), 55.2 (-OCH3),

51.5 (-OCH2), 49.5 (-OCH2), 21.1 (C-22), 20.9 (C-25),

16.5 (-CH3), 16.3 (-CH3); 31

P NMR (200 MHz, CDCl3):

δ 20.92; ESI-MS: m/z 624.28 (M + H)+. Anal Calcd

for C31H30NO11P: C, 59.71; H, 4.85; N, 2.25. Found:

C, 59.74; H,4.86; N, 2.28.

8-(Acetyloxy)-3-({[(diethoxyphosphoryl)(4-methphe-

nyl)methyl]amino}carbonyl)-9,10-dioxo-9, 10-dihydro-

1-anthracenyl acetate, 4i: Yield 81%. Pale yellow

solid. m.p. 189~191°C. IR (KBr): 1770, 1723 (C=O

stretch in ester), 1712, 1693 (C=O stretching


1312 cm-1

(C-N); 1H NMR (500 MHz, CDCl3): δ 8.65

(d, J = 7.6 Hz, 1H), 8.24 (dd, J = 7.8, 1.2 Hz, 1H),

7.92 (d, J = 7.7 Hz, 1H), 7.87 (dd, J = 9.1, 4.4 Hz,

1H), 7.79 (t, J = 7.9 Hz, 1H), 7.43 (dd, J = 8.0, 1.1

Hz, 3H), 7.18 (d, J = 8.1 Hz, 2H), 5.69 (dd, J = 20.8,

9.3 Hz, 1H), 4.21-4.11 (m, 2H), 3.99-3.93 (m, 1H),

3.75-3.70 (m, 1H), 2.45 (s, 3H), 2.45 (s, 3H), 2.34 (s,

3H),1.32 (t, J = 7.1 Hz, 3H), 1.12 (t, J = 7.1 Hz, 3H); 13

C NMR (125 MHz, CDCl3): δ 181.2 (C-10), 180.2

(C-13), 169.4 (C-23), 169.1 (C-20), 164.0 (C-18), 150.2

(C-4), 150.0 (C-5), 139.5 (C-2), 136.1 (C-1′), 134.8

(C-3), 134.3 (C-11), 134.3 (C-9), 130.6 (C-6), 129.7

(C-7), 129.6 (C-4′), 129.4 (C-12), 128.7 (C-5′), 128.6

(C-3′), 127.8 (C-6′), 127.6 (C-2′), 126.5 (C-14), 125.5

(C-8), 124.3 (C-1), 65.2 (-PCH, d, J = 3.0 Hz), 57.0 (-

OCH2), 55.8 (-OCH2), 21.1 (C-22), 20.9 (C-25), 20.3 (-

CH3), 16.5 (-CH3), 16.3 (-CH3); 31

P NMR (200 MHz,

CDCl3): δ 21.56; ESI-MS: m/z 608.23 (M + H)+. Anal

Calcd for C31H30NO10P: C, 61.28; H, 4.98; N, 2.31.

Found: C, 61.32; H, 5.01; N, 2.34%.

8-(Acetyloxy)-3-({ [ (diethoxyphosphoryl)(1-naph-

thyl)methyl]amino}carbonyl)-9, 10-dioxo-9, 10- dihydro-1-anthracenyl acetate, 4j: Yield 80%. Pale




1296 cm-1

(C-N); 1H NMR (500 MHz CDCl3): δ 0.85

(t, J = 7.0 Hz, 3H, CH3), 1.37 (t, J = 7.1 Hz, 3H,

CH3), 2.49 (s, 3H), 2.50 (s, 3H), 3.50-4.30 (m, 4H,

OCH2), 6.60 (dd, J = 22.3, 9.3Hz 1H, PCH), 7.26-8.33

(m, 12H, Ar-H, 1H, NH); 13

C NMR (125 MHz, CDCl3):


1595

δ 181.2 (C-10), 180.3 (C-13), 169.4 (C-23), 169.2 (C-20),

164.5 (C-18), 150.2 (C-4), 150.1 (C-5), 139.4 (C-2),

134.9 (C-3), 134.5 (C-11), 134.2 (C-9), 133.9 (C-1′),

132.4 (C-10′), 131.3 (C-9′), 130.5

(C-6), 129.7 (C-7), 129.5 (C-12), 128.8 (C-5′), 126.7 (C-

3′), 126.5 (C-14), 126.1 (C-2′), 125.9 (C-4′), 125.5 (C-

8), 125.5 (C-7′), 125.3 (C-6′), 123.9 (C-1), 123.3

(C-8′), 47.2 (-OCH2), 45.6 (-OCH2), 63.2 (-PCH, d, J =

3.1 Hz), 21.1 (C-22), 21.0 (C-25), 16.5 (-CH3), 16.2

(-CH3); 31

P NMR (202 MHz, CDCl3): δ 21.33; ESI-MS:

m/z 644.24 (M + H)+. Anal. Calcd for C34H30NO10P:

C, 63.45; H, 4.70; N, 2.18. Found: C, 63.44; H, 4.73;

N, 2.23%.

8-(Acetyloxy)-3-({[9-anthryl(diethoxyphosphoryl)-

methyl]amino}carbonyl)-9,10-dioxo-9,10-dihydro-

1-anthracenyl acetate, 4k: Yield 80%. Pale yellow

solid. m.p. 168~170°C. IR (KBr): 1785, 1726 (C=O

stretch in ester), 1716, 1683 (C=O stretching


1298 cm-1

(C-N); 1H NMR (500 MHz CDCl3): δ 0.63

(t, J = 7.1 Hz, 3H, CH3), 1.42 (t, J = 7.1 Hz, 3H,

CH3), 2.47 (s, 3H), 2.49 (s, 3H), 3.31-4.35 (m, 4H,

OCH2), 7.24-7.28 (m, 2H, Ar-H), 7.31 (dd, J = 25.7,

8.5 Hz 1H, PCH), 7.38-8.79 (m, 12H, Ar-H, 1H, NH); 13

C NMR (125 MHz, CDCl3): δ 181.5 (C-10), 180.2

(C-13), 169.5 (C-23), 169.1 (C-20), 164.4 (C-18),

150.3 (C-4), 150.2 (C-5), 139.3 (C-2), 134.8 (C-3),

134.4 (C-11), 134.1 (C-9), 132.7 (C-9′), 132.2 (C-12′),

132.0 (C-14′), 131.8 (C-13′), 131.6 (C-11′), 130.5 (C-

6), 129.7 (C-7), 129.5 (C-12), 128.6 (C-5′), 128.3 (C-

4′), 126.5 (C-14), 126.4 (C-1′), 126.0 (C-8′), 125.5

(C-8), 125.5 (C-2′), 125.3 (C-7′), 124.9 (C-3′), 124.7

(C-6′), 124.4 (C-10′), 123.9 (C-1), 46.6 (-OCH2), 48.5

(-OCH2), 63.0 (-PCH, d, J = 3.1 Hz), 21.1 (C-22), 21.0

(C-25), 16.5 (-CH3), 16.2 (-CH3); 31

P NMR

(200 MHz, CDCl3): δ 22.34; ESI-MS: m/z 694.25 (M +

H)+. Anal Calcd for C38H32NO10P: C, 65.80; H, 4.65;

N, 2.02. Found: C, 65.83; H, 4.62; N, 2.05%.

Acknowledgements

This study was supported by 973 projects

(No.2011CB512005, 2012CB723501), the National

Natural Science Foundation of China (No. 81260472,

21101035, 21362002), Guangxi Natural Science

Foundation of China (2011GXNSFD018010 and

No.2010GXNSFF013001), Bagui Scholar project and

the Foundation of Ministry of Education Innovation

Team (NO. IRT1225).

References 1 Dong G Q, Wang S Z, Miao Z Y, Yao J Z, Zhang Y Q, Guo

Z Z, Zhang W N & Sheng C Q, J Med Chem, 55, 2012, 7593.

2 Gilroy D W, Prostag Leukotr Ess, 73, 2005, 203.

3 Antonoff M B & D'Cunha J, Semin Thorac Cardiovasc Surg,

22, 2010, 195.

4 Singh S, Jain A, Mishra S K, Singh S & Singh R, Osteoarthr

Cartilage, 20, 2012, S127.

5 Dhaneshwar S, Patel V, Patil D & Meena G, Bioorg Med

Chem Lett, 23, 2013, 55.

6 Bartels E M, Bliddal H, Schøndorff P K, Altman R D, Zhang

W & Christensen R, Osteoarthr Cartilage, 18, 2010, 289.

7 Ramos-Zavala M G, González-Ortiz M, Martínez-Abundis

E, Robles-Cervantes J A, González-López R & Santiago-

Hernández N J, Diabetes Care, 34, 2011, 1591.

8 Huang, X C, Wang M, Pan Y M, Tian X Y, Wang H S &

Zhang Y, Bioorg Med Chem Lett, 23, 2013, 5283.

9 Ye M Y, Yao G Y, Wei J C, Pan Y M, Liao Z X & Wang H

S, Int J Mol Sci, 14, 2013, 9424.

10 Huang, X C, Wang M, Pan Y M, Yao G Y, Wang H S, Tian

X Y, Qin J K & Zhang Y, Eur J Med Chem, 69, 2013, 508.

11 Yao G Y, Ye M Y, Huang R Z, Li Y J, Pan Y M, Xu Q, Liao

Z X & Wang H S, Bioorg Med Chem Lett, 2013, DOI:

10.1016/j.bmcl.2013.12.030.

12 Jin L H, Song B A, Zhang G P, Xu R Q, Zhang S M, Gao X

W, Hu D Y & Yang S, Bioorg Med Chem Lett, 16, 2006,

1537.

13 Naydenova E, Troev K, Topashka-Ancheva M, Hägele G,

Ivanov I & Kril A, Amino Acids, 33, 2007, 695.

14 Naydenova E D, Todorov P T & Troev K D, Amino Acids,

38, 2010, 23.

15 Mucha A, Kafarski P & Berlicki Ł, J Med Chem, 54, 2011,

5955.

16 Hulsman N, Medema J P, Bos C, Jongejan A, Leurs R, Smit

M J, de Esch I J, Richel D & Wijtmans M, J Med Chem, 50,

2007, 2424.

17 Muregi F W & Ishih A, Drug Develop Res, 71, 2010, 20.

18 Metcalfe C & Thomas J A, Chem Soc Rev, 32, 2003, 215.

19 Tan J, Wang B C & Zhu L C, Bioorg Med Chem, 17, 2009,

614.

20 Tang H, Wang X D, Wei Y B, Huang S L, Huang Z S, Tan J

H, An L K, Wu J Y, Chan A S C & Gu L Q, Eur J Med

Chem, 43, 2008, 973.

21 Cashman D J & Kellogg G E, J Med Chem, 47, 2004, 1360.

22 Chaudhuri P, Majumder H K & Bhattacharya S, J Med

Chem, 50, 2007, 2536.

23 Kastan M B & Bartek J, Nature, 432, 2004, 316.

24 Tao Z F & Lin N H, Anticancer Agent Med Chem, 6, 2006,

377.

Documents

Synthesis and antitumor activities of novel diacerein …nopr.niscair.res.in/bitstream/123456789/30081/1/IJCB 53B... · 2016. 7. 20. · Diacerein, clinically used as in anti-inflammatory,