View
1
Download
0
Category
Preview:
Citation preview
advances.sciencemag.org/cgi/content/full/6/46/eabc4516/DC1
Supplementary Materials for
Repeated gain and loss of a single gene modulates the evolution of vascular plant
pathogen lifestyles
Emile Gluck-Thaler, Aude Cerutti, Alvaro L. Perez-Quintero, Jules Butchacas, Verónica Roman-Reyna, Vishnu Narayanan Madhavan, Deepak Shantharaj, Marcus V. Merfa, Céline Pesce, Alain Jauneau, Taca Vancheva,
Jillian M. Lang, Caitilyn Allen, Valerie Verdier, Lionel Gagnevin, Boris Szurek, Gregg T. Beckham, Leonardo De La Fuente, Hitendra Kumar Patel, Ramesh V. Sonti, Claude Bragard, Jan E. Leach, Laurent D. Noël,
Jason C. Slot, Ralf Koebnik*, Jonathan M. Jacobs*
*Corresponding author. Email: jacobs.1080@osu.edu (J.M.J.); koebnik@gmx.de (R.K.)
Published 13 November 2020, Sci. Adv. 6, eabc4516 (2020)
DOI: 10.1126/sciadv.abc4516
The PDF file includes:
Figs. S1 to S6 and S9 Legends for figs. S7 and S8 References
Other Supplementary Material for this manuscript includes the following: (available at advances.sciencemag.org/cgi/content/full/6/46/eabc4516/DC1)
Tables S1 to S8
Figure S1. Evolutionary relationship between vascular pathogenesis and a conserved cell wall-degrading enzyme in Xanthomonas bacteria. This figure is a modified Fig. 1 with detailed strain information for genomes analyzed. To explore the association of the vascular/non-vascular lifestyle a set of publicly available complete and annotated genomes from different species in the Xanthomonadaceae family was analyzed. A pan genome SNP-based parsimony tree was built using kSNP3 (optimum kmer size = 21)(26). Genomes were classified as vascular (blue), non-vascular (yellow) or unknown (gray) based on available information in the literature. Ortholog groups for all annotated proteins were identified using Orthofinder (44), and a parsimony tree was generated based on pan-genome SNPs using KSNP3. Associations were identified between the presence/absence of each orthologue group in the analyzed genomes and the vascular/non-vascular trait according to the phylogeny using BayesTraitsV3. The likelihood that both traits (vascularity vs. gene presence) evolved dependently was compared to the likelihood they evolved dependently. Evidence of dependent evolution was assessed as Log Bayes Factors = 2(log marginal likelihood dependent model – log marginal likelihood independent model). Gene groups that were determined to evolve dependent on vascularity with very strong evidence (logBF >10; dark red) are shown, as well as the next top 12 genes below the threshold (light red), genes are marked in red when present in a given strain. One gene group (OG0003492; CbsA) was commonly found in vascular strains, and the other (OG0002818; hypothetical) was more common in non-vascular genomes.
CbsA
hyp1
Figure S2. Vascular, xylem pathogenesis strongly correlates with presence of cbsA but not host species. A phylogenetic tree was created based on representative xanthomonad genomes from NCBI with Average Nucleotide Identity (ANI) (http://enve-omics.ce.gatech.edu/g-matrix/). Vascular, xylem-colonizing bacteria are denoted in blue. Black boxes identify genomes with a cbsA homolog. Primary, characterized host for each pathogen is listed to the right of the boxes.
2.0
X. translucens pv. translucens UPB 787
X. albilineans GPEPC73
X. campestris pv. raphani 756C
X. citri pv. citri 306
X. sacchari R1
X. translucens pv. undulosa 4699
X. oryzae pv. oryzicola BLS256
X. oryzae pv. oryzae PXO86
X. campestris pv. campestris 8004
X. euvesicatoria 85-10
Xylella fastidiosa 9a5c
barley
barley
sugar cane
sugar cane
cabbage
cabbage
rice
rice
citrus
pepper
citrus
vasc
ular
cbsA
Figure S3. The evolution and genomic context of cbsA. To the left is a nucleotide-based maximum likelihood phylogeny of cbsA homologs retrieved from the genome database from this paper (see Table S1). Bootstrap support values (out of 100) are indicated above each bipartition. Each tip of the tree lists the full name of the isolate from which the sequence was retrieved in addition to the sequence’s accession number. To the right are schematics of the four distinct types of gene neighborhoods in which cbsA sequences are found. The colored species names (fuchsia, green and orange) signify horizontal transfer events. All schematics are drawn to scale within each column. Genes belonging to orthogroups of interest are color-coded (see legend at bottom), while all other intervening genes are left blank.
100
Xylella fastidiosa M12Xfas2_YP_001775232.1
91
Xylella fastidiosa 9a5cXfas1_NP_298556.1
100Xylella fastidiosa Temecula1Xfas4_NP_778753.1Xylella fastidiosa M23Xfas3_YP_001829271.1
100
57
72X. albilineans GPEPC73XaGP-ASM8796_CBA15018.1
Xylophilus ampelinus CECT-7646 (b-proteobacteria)Xa-ASM321757_PYE73410.1
91
Ralstonia solanacearum UW25 (b-proteobacteria)Rs-ASM225169_OYQ09322.1
75Ralstonia solanacearum UW551 (b-proteobacteria)Rs-ASM225165_OYQ03146.1Ralstonia solanacearum GMI1000 (b-proteobacteria)Rsol1_NP_522144.1
64
X. translucens pv. translucens DSM18974XtptD1-PBasm1_SCB03884.1
98
100
80
100X. citri pv. glycines str. 12-2Xcpgs1-ASM216377_ARV24394.1X. citri pv. glycines str. 8raXcpgs8-ASM185414_AOY64814.1
100X. vesicatoria LM159Xv-ASM190881_APO94904.1X. vesicatoria ATCC 35937XvA3-ASM190872_APP77676.1
100
X. campestris pv. campestris ICMP21080Xcpc-ASM118641_AKS15321.1
57
X. campestris pv. raphani 756CXcpr7-ASM22196_AEL08359.1
100X. campestris pv. campestris str. 8004Xcpcs8-ASM1210_AAY48079.1X. campestris pv. campestris str. ATCC33913XcpcsA3-ASM714_AAM42430.1
100
X. vasicola pv. vasculorum SAM119Xvpv-ASM301571_AVQ05843.1
100
100
X. oryzae pv. oryzae PXO71Xopo-ASM174659_AOS03942.1
57X. oryzae pv. oryzae PXO99AXopoP-ASM1958_ACD57472.1X. oryzae pv. oryzae MAI1Xopo-ASM303136_AVT98064.1
41
100
X. campestris pv. campestris ICMP21080Xcpc-ASM118641_AKS14997.1
32X. campestris pv. campestris str. ATCC33913XcpcsA3-ASM714_AAM42804.1X. campestris pv. campestris str. 8004Xcpcs8-ASM1210_AAY47706.1
39
100X. citri pv. phaseoli var. fuscans CFBP6996RXcppvf-ASM275919_ATS59881.1X. citri pv. vignicola CFBP7112Xcpv-ASM221826_ASK95409.1
100
X. phaseoli pv. phaseoli CFBP6546RXppp-ASM275913_ATS29879.1
42X. phaseoli pv. phaseoli CFBP6164Xppp-ASM275911_ATS26645.1X. phaseoli pv. phaseoli CFBP6982Xppp-ASM275915_ATS34908.1
1 2 3 4Neighborhood type
Transposable elementOG0000664 OG0003164 OG0001552OG0000419 OG0000889 OG0002828OG0000563 OG0000888 OG0000035
OG0000234 OG0001138 OG0000202OG0002434 OG0003475 OG0003060OG0002170 OG0003407 OG0001360OG0000169
cbsA CDSvascular lifestyle
Figure S4. Specific inactivation events for cbsA homologs in Xanthomonas spp. cbsA genes or genomic regions were aligned from vascular and non-vascular A) Xanthomonas translucens, B) Xanthomonas oryzae and C) Xanthomonas campestris with A&B) MAFFT alignment (www.benchling.com) and C) MAUVE. A&B) Gray and red signify the same or different respective nucleotide in the alignment. cbsA homologs were independently interrupted by three independent events: A) insertion, B) small deletion and C) complete gene loss. B) For Xanthomonas oryzae pathovars, the presence of CbsA (black circles) was strongly correlated with vascular (black circles) X. oryzae pv. oryzae genomes but absent from non-vascular (white circles) X. oryzae pv. oryzae. C) X. campestris pv. campestris is vascular, while X. campestris pv. raphani is non-vascular. Green signifies level of identity between a given nucleotide sequences.
Xta UPB455Xtg ART-Xtg29Xtg CNC2-P4Xtt DSM18974Xtt UPB787Xtc CFPB2541Xtc NCPPB1943Xtu BLBW16Xtu BLSB3Xt SIMT07Xt SLV-2Xtu NARK-1Xt DAR61454
0 nt
200
400
600 80
010
00 1200
1400
vascularnon-vascular
GAGGGTCAGGGCTAATCAGGAGACCTTATGTGCGpart of transposase
transposase-------- ----
cbsA
celA1 cellulase
cellulase
X. campestris pv. campestris
X. campestris pv. raphani
B
C
A
cbsA
cbsA
cbsA
cbsAva
scular?
Figure S5. Mutation of cbsA negatively affects virulence in X. oryzae pv. oryzae and Xylella fastidiosa. A) Rice plants (cv. Nipponbare) were inoculated with X. oryzae pv. oryzae wild-type or ∆cbsA mutant. A-B) Lesion lengths were measured and imaged 15 days post inoculation (Photo Credit: V. Narayanan Madhavan, CSIR). Lesion length was compared with Student’s t-test (P<0.0001). C-E) Disease severity progression over time in inoculated tobacco plants. Xylella fastidiosa subsp. fastidiosa strain TemeculaL (WT) and mutant ∆cbsA were inoculated into Nicotiana tabacum L. cv. Petit Havana SR1 plants (PBS mock inoculation used as control). Leaf scorch symptoms were recorded for measurements of disease incidence and severity once a week during ten weeks after appearance of the first disease symptoms. At the final time point of evaluation, disease incidence in TemeculaL WT reached 100%, compared to mutant ∆cbsA reaching 66%; while disease severity reached 95% in WT and 54% in ∆cbsA. The mutant ∆cbsA showed delay of leaf scorch symptom development, with symptom appearance at the seventh week onwards and mostly restricted to lower leaves close to the inoculation point. Data represent means and standard errors from one experiment (n=9 for WT and ∆cbsA). D) Mean AUDPC per treatment group (WT and ∆cbsA). AUDPC was calculated using data from disease severity over ten weeks after first disease symptom appearance. AUDPC was lower for plants inoculated with ∆cbsA, in comparison to WT-inoculated plants. Data represent means and standard errors. Statistical significance was calculated using Tukey-Kramer HSD (P<0.05) (Statistical software JMP 15.0.1, 2015 SAS Inst. Inc., Cary, NC). E) Representative image of leaf scorch symptoms in WT- and ∆cbsA-inoculated plants, as well as control plants (PBS-inoculated; Photo Credit: D. Shantharaj, Auburn). Arrows in figures point to symptomatic leaves, which were distributed throughout the entire plant in WT-inoculated plants, and were mainly restricted to basal and middle leaves in ∆cbsA-inoculated plants.
Figure S6. The distribution of cbsA loci across beta- and gamma-proteobacteria (unedited version of Figure 1). Shown to the left is a majority rule consensus tree based on 81 maximum likelihood trees of single copy orthologs that summarizes species relationships among 86 bacteria examined in this study. Each bifurcation in the consensus tree is present in at least 50% of the single copy ortholog trees. Branch support values indicate internode certainty (ranging from 0-1), which quantifies the degree of conflict associated with a given bipartition across all 81 constituent trees. To the right of the tree is a graphic summarizing the distribution of the four distinct neighborhoods in which cbsA is found across each genome, in all cases whether cbsA is present or not. All neighborhood schematics are drawn to scale within each column. Genes
0.72
1.0
0.47
0.9
0.33
0.65
0.73
0.34
0.62
0.57X. citri pv. glycines str. 12-2Xcpgs1-ASM216377X. citri pv. glycines str. 8raXcpgs8-ASM185414X. citri subsp. malvacearum MSCTXcsm-ASM171914X. citri subsp. citri AW15Xcsc-ASM96147X. citri pv. mangiferaeindicae LMG941XcpmL9-XALMG941X. citri pv. punicae str. LMG859XcppsL8-ASM28577X. citri subsp. malvacearum AR81009Xcsm-ASM228856X. axonopodis pv. malvacearum str. GSPB2388XapmsG-ASM30992X. axonopodis pv. citri str. 306Xapcs3-ASM716X. citri subsp. citri jx4Xcsc-ASM96131X. axonopodis Xac29-1XaX-ASM34858
0.77
0.45X. citri pv. phaseoli var. fuscans CFBP6990Xcppvf-ASM275931X. citri pv. phaseoli var. fuscans CFBP6989Xcppvf-ASM275929
0.53X. fuscans subsp. aurantifolii FDC1559Xfsa-ASM161079X. fuscans subsp. aurantifolii FDC1609Xfsa-ASM161081X. fuscans subsp. aurantifolii 1566Xfsa-ASM161091X. citri pv. vignicola CFBP7111Xcpv-ASM221824X. citri pv. vignicola CFBP7113Xcpv-ASM221828X. citri pv. phaseoli var. fuscans CFBP6996RXcppvf-ASM275919X. citri pv. vignicola CFBP7112Xcpv-ASM221826
0.73
0.62X. campestris pv. vesicatoria str. 85-10Xcpvs8-ASM185416X. euvesicatoria LMG930Xe-ASM190879
0.53X. perforans 91-118Xp9-ASM19204X. perforans LH3Xp-ASM190885X. axonopodis pv. citrumelo F1XapcF-ASM22591
0.82
X. phaseoli pv. phaseoli CFBP6982Xppp-ASM275915X. phaseoli pv. phaseoli CFBP6546RXppp-ASM275913X. phaseoli pv. phaseoli CFBP6164Xppp-ASM275911
0.9
0.59
0.16X. oryzae pv. oryzicola BLS256XopoB-ASM16831X. oryzae pv. oryzicola B8-12Xopo-ASM104274X. oryzae pv. oryzicola CFBP7331Xopo-ASM104281
0.7X. oryzae pv. oryzae PXO99AXopoP-ASM1958X. oryzae pv. oryzae PXO71Xopo-ASM174659X. oryzae pv. oryzae MAI1Xopo-ASM303136X. vasicola pv. vasculorum SAM119Xvpv-ASM301571
0.9
0.42X. gardneri ICMP7383Xg-ASM190877X. hortorum B07-007Xh-ASM228551X. gardneri JS749-3Xg-ASM190875
1.0
X. fragariae PD885Xf-PD885.1X. fragariae PD5205Xf-PD5205.1X. fragariae Fap21Xf-ASM170556
1.0X. vesicatoria LM159Xv-ASM190881X. vesicatoria ATCC 35937XvA3-ASM190872
0.9
0.51
0.06X. campestris pv. campestris str. ATCC33913XcpcsA3-ASM714X. campestris pv. campestris str. 8004Xcpcs8-ASM1210X. campestris pv. campestris ICMP21080Xcpc-ASM118641X. campestris pv. raphani 756CXcpr7-ASM22196
0.83
1.0
0.56X. translucens pv. undulosa 4699Xtpu-ASM102193X. translucens pv. cerealis ICMP11055Xtpc-ASM305068X. translucens pv. translucens DSM18974XtptD1-PBasm1
0.3X. sacchari R1Xs-ASM81518X. albilineans GPEPC73XaGP-ASM8796
1.0
1.0
0.37
0.9Xylella fastidiosa M23Xfas3Xylella fastidiosa Temecula1Xfas4Xylella fastidiosa M12Xfas2Xylella fastidiosa 9a5cXfas1Xylella taiwanensis PLS235Xt-ASM335278
Lysobacter antibioticus ATCC29479La-ASM144253
Unknown sp.Xcpm-ASM224039
0.81
0.2Salmonella enterica LT2SesesTsL-ASM694Vibrio tubiashii ATCC 19109VtA1-ASM77210Shewanella oneidensis MR-1SoM-ASM14616Aeromonas hydrophila subsp. hydrophila ATCC7966AhshA7-ASM1480Beggiatoa leptomitoformis D-402Bl-ASM130557Methylomonas denitriÀcans FJG1Md-ASM78570Nitrosococcus halophilus Nc4NhN-ASM2472Cellvibrio japonicus Ueda107CjU-ASM1922Marinomonas mediterranea MMB-1MmM-ASM19286Pseudomonas syringae pv. tomato DC3000PsptsD-ASM780Legionella fallonii LLAP-10LfL-LFA
0.72
0.63
0.9
0.83
0.52
0.69
0.2Ralstonia solanacearum CFBP2957 (b-proteobacteria) Rsol2Ralstonia solanacearum UW25 (b-proteobacteria)Rs-ASM225169Ralstonia solanacearum UW551 (b-proteobacteria)Rs-ASM225165
1.0Ralstonia solanacearum PSI07 (b-proteobacteria) Rsol3Ralstonia syzygii blood disease bacterium R229 (b-proteobacteria)RsygR229
0.69Ralstonia solanacearum CMR15 (b-proteobacteria)RsC-ASM42719Ralstonia solanacearum GMI1000 (b-proteobacteria) Rsol1
0.9Ralstonia pickettii 12D (b-proteobacteria) Rpic1Ralstonia pickettii 12J (b-proteobacteria) Rpic2
1.0Cupriavidus pinatubonensis JMP134 (b-proteobacteria)Reut2Cupriavidus necator H16 (b-proteobacteria)Reut1
1.0Xylophilus sp. Leaf220 (b-proteobacteria)XsL-Leaf220Xylophilus ampelinus CECT-7646 (b-proteobacteria)Xa-ASM321757Nitrosomonas communis Nm2 (b-proteobacteria)Nc-ASM100793Chromobacterium violaceum ATCC12472 (b-proteobacteria)CvA1-ASM770Thauera chlorobenzoica 3CB1 (b-proteobacteria)Tc-ASM192230
1 2 3 4Neighborhood type
celA CDS
Transposable elementComplete celA CDS
OG0000664 OG0003164 OG0001552OG0000419 OG0000889 OG0002828OG0000563 OG0000888 OG0000035
OG0000234 OG0001138 OG0000202OG0002434 OG0003475 OG0003060OG0002170 OG0003407 OG0001360
OG0000169 vascular lifestyle
belonging to orthogroups of interest are color-coded (see legend at bottom), while all other intervening genes are left blank.
See additional file attached (too large for supplemental document).
Figure S7. Mid-point rooted, nucleotide-based maximum likelihood phylogenies of all genes in the type 4 cbsA neighborhood. Bootstrap support values (out of 100) are indicated above each bipartition. Each tip of the tree lists the full name of the isolate from which the sequence was retrieved in addition to the sequence’s accession number. Tree tips associated with sequences from X. campestris are colored orange, while tips associated with sequences from X. citri pv. phaseoli, X. citri pv. vignicola and X. fuscans are colored green. In topologies suggesting horizontal gene transfer (HGT), colored sequences were forced to be monophyletic in order to generate constrained topologies that would be expected under a scenario of vertical inheritance for phylogenetic hypothesis testing (Methods; Tables S4-5). A schematic of a cbsA gene neighborhood from X. oryzae pv. oryzae strain MAI1 is drawn above each tree, and a black vertical triangle indicates the current gene tree being displayed. Boundaries of the inferred homologous recombination events (Methods) are indicated by dashed lines, and are colored green for the HGT from the X. phaseoli clade to X. campestris and orange for the HGT from the X. phaseoli clade to X. citri pv. vignicola CFBP7112 and X. citri pv. phaseoli var. fuscans CFBP6996R. a) OG0001552. b) OG0002828. c) OG0000035 and 5’ UTR, partition 2. d) OG0000035 and 5’ UTR, partition 1. e) OG0000234. f) OG0002434. g) OG0002170.
See additional file attached (too large for supplemental document).
Figure S8. Mid-point rooted, nucleotide-based maximum likelihood phylogenies of all genes in the type 3 cbsA neighborhood, with midpoint rooting. Bootstrap support values (out of 100) are indicated above each bipartition. Each tip of the tree lists the full name of the isolate from which the sequence was retrieved in addition to the sequence’s accession number. Tree tips associated with sequences from X. citri pv. glycines, X. citri pv. punicae, X. citri subsp. malvacearum, X. citri pv. mangiferaeindicae, X. citri subsp. citri and X. axonopodis pv. citri are colored pink. In topologies suggesting horizontal gene transfer (HGT), colored sequences were forced to be monophyletic in order to generate constrained topologies that would be expected under a scenario of vertical inheritance for phylogenetic hypothesis testing (Methods; Table S6). A schematic of a cbsA gene neighborhood taken from X. citri pv. glycines str. 8a is drawn above each tree, and a black vertical triangle indicates the current gene being viewed. The boundaries of the inferred homologous recombination event (Methods) from X. vesicatoria to X. citri pv. glycines is indicated by black dashed lines. A black bracket indicates the boundaries of a 9-gene region that was likely inserted into the cbsA neighborhood after the HGT event. a) OG0003189. b) OG0003864. c) OG0001138. d) OG0003475. e) OG0003407. f) OG0006923. g) OG0000202. h) OG0012116. i) OG0006653. j) OG0004064. k) OG0005040. l) OG0015184. m) OG0004674. n) OG0005551. o) OG0003060. p) OG0001360. q) OG0000926. r) OG0002126. s) OG0001639. t) OG0001483. u) OG0001080. v) OG0000801, partition 2. w) OG0000801, partition 1. x) OG0001155. y) OG0001453.
Fig. S9. Complete, whole genome sequencing validation of X. translucens pv. translucens ∆cbsA. We were unable to create a miniTn7::cbsA complementation of X. translucens pv. translucens UPB886 by transformation or conjugation. Therefore, we performed whole genome sequencing to define the ∆cbsA mutation in UPB886. Genomic DNA from X. translucens pv. translucens ∆cbsA extracted with QIAGEN Genomic-tips 100G kit and sequenced by Psomagen, Inc using Pacbio RSII 20Kb SMRTbell. Assembly was done using Flye software with the parameters --pacbio-raw –g 5m (45). Genome annotation was done with Prokka (46). Genome comparisons and variant call was done using Mauve and NUCmer alignments (47). A MAUVE genome alignment of wild-type X. translucens UPB886 (Xtt886, top) compared to X. translucens pv. translucens ∆cbsA (UPB886c, bottom) demonstrates that the ∆cbsA gene was completely deleted by sacB mutagenesis for the cbsA loci (48, 49). Red signifies level of homology between sequences with specific open reading frames in boxes below for each genome. The empty gray space above signifies no sequence identity and demonstrates the deletion for the Xtt UPB886 ∆cbsA mutant below.
Tables S1-S8. See additional file attached for supplemental tables.
REFERENCES AND NOTES
1. J. Iranzo, Y. I. Wolf, E. V. Koonin, I. Sela, Gene gain and loss push prokaryotes beyond the
homologous recombination barrier and accelerate genome sequence divergence. Nat.
Commun. 10, 5376 (2019).
2. E. V. Koonin, Y. I. Wolf, Genomics of bacteria and archaea: The emerging dynamic view of
the prokaryotic world. Nucleic Acids Res. 36, 6688–6719 (2008).
3. A. T. Maurelli, R. E. Fernández, C. A. Bloch, C. K. Rode, A. Fasano, “Black holes” and
bacterial pathogenicity: A large genomic deletion that enhances the virulence of Shigella spp.
and enteroinvasive Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 95, 3943–3948 (1998).
4. C.-H. Kuo, H. Ochman, Deletional bias across the three domains of life. Genome Biol. Evol. 1,
145–152 (2009).
5. R. A. Melnyk, S. S. Hossain, C. H. Haney, Convergent gain and loss of genomic islands drive
lifestyle changes in plant-associated Pseudomonas. ISME J. 13, 1575–1588 (2019).
6. S. S. Porter, J. Faber-Hammond, A. P. Montoya, M. L. Friesen, C. Sackos, Dynamic genomic
architecture of mutualistic cooperation in a wild population of Mesorhizobium. ISME J. 13,
301–315 (2019).
7. K. G. Nandasena, G. W. O’Hara, R. P. Tiwari, J. G. Howieson, Rapid in situ evolution of
nodulating strains for Biserrula pelecinus L. through lateral transfer of a symbiosis island
from the original Mesorhizobial inoculant. Appl. Environ. Microbiol. 72, 7365–7367 (2006).
8. E. A. Savory, S. L. Fuller, A. J. Weisberg, W. J. Thomas, M. I. Gordon, D. M. Stevens, A. L.
Creason, M. S. Belcher, M. Serdani, M. S. Wiseman, N. J. Grünwald, M. L. Putnam, J. H.
Chang, Evolutionary transitions between beneficial and phytopathogenic Rhodococcus
challenge disease management. eLife 6, e30925 (2017).
9. J. M. Jacobs, L. Babujee, F. Meng, A. Milling, C. Allen, The in planta transcriptome of
Ralstonia solanacearum: Conserved physiological and virulence strategies during bacterial
wilt of tomato. MBio 3, e00114-12 (2012).
10. M.-A. Jacques, M. Arlat, A. Boulanger, T. Boureau, S. Carrère, S. Cesbron, N. W. G. Chen,
S. Cociancich, A. Darrasse, N. Denancé, M. Fischer-Le Saux, L. Gagnevin, R. Koebnik, E.
Lauber, L. D. Noël, I. Pieretti, P. Portier, O. Pruvost, A. Rieux, I. Robène, M. Royer, B.
Szurek, V. Verdier, C. Vernière, Using ecology, physiology, and genomics to understand
host specificity in Xanthomonas. Annu. Rev. Phytopathol. 54, 163–187 (2016).
11. D. Barker, M. Pagel, Predicting functional gene links from phylogenetic-statistical analyses
of whole genomes. PLOS Comput. Biol. 1, e3 (2005).
12. L. Tayi, S. Kumar, R. Nathawat, A. S. Haque, R. V. Maku, H. K. Patel, R.
Sankaranarayanan, R. V. Sonti, A mutation in an exoglucanase of Xanthomonas oryzae pv.
oryzae, which confers an endo mode of activity, affects bacterial virulence, but not the
induction of immune responses, in rice. Mol. Plant Pathol. 19, 1364–1376 (2018).
13. G. T. Beckham, J. Ståhlberg, B. C. Knott, M. E. Himmel, M. F. Crowley, M. Sandgren, M.
Sørlie, C. M. Payne, Towards a molecular-level theory of carbohydrate processivity in
glycoside hydrolases. Curr. Opin. Biotechnol. 27, 96–106 (2014).
14. C. Bragard, E. Singer, A. Alizadeh, L. Vauterin, H. Maraite, J. Swings, Xanthomonas
translucens from small grains: Diversity and phytopathological relevance. Phytopathology
87, 1111–1117 (1997).
15. C. Pesce, J. M. Jacobs, E. Berthelot, M. Perret, T. Vancheva, C. Bragard, R. Koebnik,
Comparative genomics identifies a novel conserved protein, HpaT, in proteobacterial type III
secretion systems that do not possess the putative translocon protein HrpF. Front. Microbiol.
8, 1177 (2017).
16. G. Jha, R. Rajeshwari, R. V. Sonti, Functional interplay between two Xanthomonas oryzae
pv. oryzae secretion systems in modulating virulence on rice. Mol. Plant Microbe Interact.
20, 31–40 (2007).
17. H. Liu, S. Zhang, M. A. Schell, T. P. Denny, Pyramiding unmarked deletions in Ralstonia
solanacearum shows that secreted proteins in addition to plant cell-wall-degrading enzymes
contribute to virulence. Mol. Plant Microbe Interact. 18, 1296–1305 (2005).
18. J. F. González, G. Degrassi, G. Devescovi, D. De Vleesschauwer, M. Höfte, M. P. Myers, V.
Venturi, A proteomic study of Xanthomonas oryzae pv. oryzae in rice xylem sap. J.
Proteomics 75, 5911–5919 (2012).
19. C. de Azevedo Souza, S. Li, A. Z. Lin, F. Boutrot, G. Grossmann, C. Zipfel, S. C.
Somerville, Cellulose-derived oligomers act as damage-associated molecular patterns and
trigger defense-like responses. Plant Physiol. 173, 2383–2398 (2017).
20. R. Albalat, C. Cañestro, Evolution by gene loss. Nat. Rev. Genet. 17, 379–391 (2016).
21. A. K. Hottes, P. L. Freddolino, A. Khare, Z. N. Donnell, J. C. Liu, S. Tavazoie, Bacterial
adaptation through loss of function. PLOS Genet. 9, e1003617 (2013).
22. B. J. Shapiro, J. Friedman, O. X. Cordero, S. P. Preheim, S. C. Timberlake, G. Szabó, M. F.
Polz, E. J. Alm, Population genomics of early events in the ecological differentiation of
bacteria. Science 336, 48–51 (2012).
23. C.-L. Huang, P.-H. Pu, H.-J. Huang, H.-M. Sung, H.-J. Liaw, Y.-M. Chen, C.-M. Chen, M.-
B. Huang, N. Osada, T. Gojobori, T.-W. Pai, Y.-T. Chen, C.-C. Hwang, T.-Y. Chiang,
Ecological genomics in Xanthomonas: The nature of genetic adaptation with homologous
recombination and host shifts. BMC Genomics 16, 188 (2015).
24. N. Potnis, P. P. Kandel, M. V. Merfa, A. C. Retchless, J. K. Parker, D. C. Stenger, R. P. P.
Almeida, M. Bergsma-Vlami, M. Westenberg, P. A. Cobine, L. De La Fuente, Patterns of
inter- and intrasubspecific homologous recombination inform eco-evolutionary dynamics of
Xylella fastidiosa. ISME J. 13, 2319–2333 (2019).
25. E. A. Newberry, R. Bhandari, G. V. Minsavage, S. Timilsina, M. O. Jibrin, J. Kemble, E. J.
Sikora, J. B. Jones, N. Potnis, Independent evolution with the gene flux originating from
multiple Xanthomonas species explains genomic heterogeneity in Xanthomonas perforans.
Appl. Environ. Microbiol. 85, e00885-19 (2019).
26. D. M. Emms, S. Kelly, OrthoFinder: Solving fundamental biases in whole genome
comparisons dramatically improves orthogroup inference accuracy. Genome Biol. 16, 157
(2015).
27. P. Jones, D. Binns, H.-Y. Chang, M. Fraser, W. Li, C. McAnulla, H. McWilliam, J. Maslen,
A. Mitchell, G. Nuka, S. Pesseat, A. F. Quinn, A. Sangrador-Vegas, M. Scheremetjew, S.-Y.
Yong, R. Lopez, S. Hunter, InterProScan 5: Genome-scale protein function classification.
Bioinformatics 30, 1236–1240 (2014).
28. S. N. Gardner, T. Slezak, B. G. Hall, kSNP3.0: SNP detection and phylogenetic analysis of
genomes without genome alignment or reference genome. Bioinformatics 31, 2877–2878
(2015).
29. P. P. Kandel, H. Chen, L. De La Fuente, A short protocol for gene knockout and
complementation in Xylella fastidiosa shows that one of the Type IV pilin paralogs (PD1926)
is needed for twitching while another (PD1924) affects pilus number and location. Appl.
Environ. Microbiol. 84, e01167-18 (2018).
30. K.-H. Choi, H. P. Schweizer, mini-Tn7 insertion in bacteria with single attTn7 sites:
Example Pseudomonas aeruginosa. Nat. Protoc. 1, 153–161 (2006).
31. L. Tayi, R. Maku, H. K. Patel, R. V. Sonti, Action of multiple cell wall–degrading enzymes
is required for elicitation of innate immune responses during Xanthomonas oryzae pv. oryzae
infection in rice. Mol. Plant Microbe Interact. 29, 599–608 (2016).
32. S.-W. Han, C.-J. Park, S.-W. Lee, P. C. Ronald, An efficient method for visualization and
growth of fluorescent Xanthomonas oryzae pv. oryzae in planta. BMC Microbiol. 8, 164
(2008).
33. B. Yang, A. Bogdanove, Inoculation and virulence assay for bacterial blight and bacterial
leaf streak of rice. Methods Mol. Biol. 956, 249–255 (2013).
34. L. Salichos, A. Rokas, Inferring ancient divergences requires genes with strong phylogenetic
signals. Nature 497, 327–331 (2013).
35. K. Katoh, D. M. Standley, MAFFT multiple sequence alignment software version 7:
Improvements in performance and usability. Mol. Biol. Evol. 30, 772–780 (2013).
36. S. Capella-Gutierrez, J. M. Silla-Martínez, T. Gabaldón, trimAl: A tool for automated
alignment trimming in large-scale phylogenetic analyses. Bioinformatics 25, 1972–1973
(2009).
37. L.-T. Nguyen, H. A. Schmidt, A. von Haeseler, B. Q. Minh, IQ-TREE: A fast and effective
stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 32,
268–274 (2015).
38. A. Stamatakis, RAxML version 8: A tool for phylogenetic analysis and post-analysis of large
phylogenies. Bioinformatics 30, 1312–1313 (2014).
39. P. Siguier, J. Perochon, L. Lestrade, J. Mahillon, M. Chandler, ISfinder: The reference centre
for bacterial insertion sequences. Nucleic Acids Res. 34, D32–D36 (2006).
40. B. Boussau, L. Guéguen, M. Gouy, A mixture model and a hidden markov model to
simultaneously detect recombination breakpoints and reconstruct phylogenies. Evol.
Bioinform Online 5, 67–79 (2009).
41. H. Shimodaira, An approximately unbiased test of phylogenetic tree selection. Syst. Biol. 51,
492–508 (2002).
42. J. Huerta-Cepas, F. Serra, P. Bork, ETE 3: Reconstruction, analysis, and visualization of
phylogenomic data. Mol. Biol. Evol. 33, 1635–1638 (2016).
43. M. J. Sullivan, N. K. Petty, S. A. Beatson, Easyfig: A genome comparison visualizer.
Bioinformatics 27, 1009–1010 (2011).
44. D. M. Emms, S. Kelly, OrthoFinder: Phylogenetic orthology inference for comparative
genomics. Genome Biol. 20, 238 (2019).
45. M. Kolmogorov, J. Yuan, Y. Lin, P. A. Pevzner, Assembly of long, error-prone reads using
repeat graphs. Nat. Biotechnol. 37, 540–546 (2019).
46. T. Seemann, Prokka: Rapid prokaryotic genome annotation. Bioinformatics 30, 2068–2069
(2014).
47. G. Marçais, A. L. Delcher, A. M. Phillippy, R. Coston, S. L. Salzberg, A. Zimin, MUMmer4:
A fast and versatile genome alignment system. PLOS Comput. Biol. 14, e1005944 (2018).
48. A. C. E. Darling, B. Mau, F. R. Blattner, N. T. Perna, Mauve: Multiple alignment of
conserved genomic sequence with rearrangements. Genome Res. 14, 1394–1403 (2004).
49. V. Roman-Reyna, E. K. Luna, C. Pesce, T. Vancheva, C. Chang, J. Ziegle, C. Bragard, R.
Koebnik, J. M. Lang, J. E. Leach, J. M. Jacobs, Genome resource of barley bacterial blight
and leaf streak pathogen Xanthomonas translucens pv. translucens strain UPB886. Plant Dis.
104, 13–15 (2020).
Recommended