Cloning and molecular characterization of vff1 gene ...darwin.bth.rwth-aachen.de/opus3/volltexte/2007/2087/pdf/Fontanell... · II.2.5 Libraries construction and screening strategies

Cloning and molecular characterization of vff1 gene encoding Forisomes of Vicia faba

Von der Fakultt fr Mathematik, Informatik and Naturwissenschaften der Rheinisch-Westflischen Technischen Hochschule Aachen zur Erlangung des akademischen

Grades einer Doktorin der Naturwissenschaften genehmigte Dissertation

vorgelegt von

M. Sc. Maria Eugenia Fontanellaz

aus Rosario, Argentinien

Berichter: Universittsprofessor Dr. rer. nat. R. Fischer Universittsprofessor Dr. rer. nat. D. Prfer Tag der mndlichen Prfung: 7. Dezember 2006

Diese Dissertation ist auf den Internetseiten der Hochschulbibliothek online verfgbar.

Contents ___________________________________________________________________________

I

I INTRODUCTION

I.1 Phloem structure and function 1

I.1.1 Sieve element-companion cell complex 1

I.1.2 P-Proteins and regulation of phloem transport 2

I.1.3 Forisomes 5

I.1.4 Ca2+-binding motifs and secondary protein structures 7

I.1.4.1 EF-hand 7

I.1.4.2 Coiled-coil domains 8

I.2 Promoter sequences and regulation of transcription 9

I.2.1 Phloem-specific promoters 9

I.3 Aim of this thesis 12

II MATERIALS AND METHODS 14

II.1 Materials 14

II.1.1 Chemicals and consumables 14

II.1.2 Enzymes and reaction kits 14

II.1.3 Buffers, media and solutions 15

II.1.4 Matrices and membranes 15

II.1.5 Primary antibodies, secondary antibodies and substrates 15

II.1.6 Biological material 15

II.1.6.1 Bacterial strains 15

II.1.6.2 Plants 16

II.1.6.3 Animals 16

II.1.7 Vectors 16

II.1.7.1 Bacterial expression vector 16

II.1.7.2 Plant expression vectors 17

II.1.8 Oligonucleotides 17

II.1.9 Equipment and applications 18

II.2 Methods 20

II.2.1 Plant material and isolation of Forisomes 20

II.2.2 Peptides sequencing 20

II.2.3 Isolation of genomic plant DNA 21

Contents ___________________________________________________________________________

II

II.2.4 RNA isolation 21

II.2.5 Libraries construction and screening strategies 22

II.2.5.1 cDNA expression library 22

II.2.5.2 cDNA libraries 22

II.2.6 PCR technologies 24

II.2.6.1 Cloning of 5 and 3 ends of full-length cDNAs using

RACE-PCR 24

II.2.6.2 PCR amplification of cDNA 25

II.2.6.3 Identification of introns and genomic DNA cloning by

LD PCR 26

II.2.6.4 Genome Walking 26

II.2.7 Recombinant DNA technologies 27

II.2.7.1 Isolation of plasmid DNA from E.coli 27

II.2.7.2 Quantification of DNA 27

II.2.7.3 PCR amplification 27

II.2.7.4 Agarose gel electrophoresis of DNA 28

II.2.7.5 Preparative agarose gel electrophoresis 28

II.2.7.6 DNA sequence analysis 29

II.2.8 Preparation and transformation of E. coli 29

II.2.8.1 Preparation of electro-competent E. coli 29

II.2.8.2 Transformation of E. coli by electroporation 29

II.2.8.3 Culturing of E. coli and glycerol stock preparation 29

II.2.9 Preparation and transformation of Agrobacterium tumefaciens 30

II.2.9.1 Preparation of electro-competent Agrobacterium cells 30

II.2.9.2 Transformation of Agrobacterium by electroporation 30

II.2.9.3 Determination of the efficiency of recombinant bacteria

transformation 31

II.2.9.4 Growth of recombinant A. tumefaciens and preparation

of glycerol stocks 31

II.2.10 Generation and characterisation of transgenic plants 31

II.2.10.1 Transient transformation of tobacco leaves 31

II.2.10.2 Preparation of recombinant Agrobacteria 31

II.2.10.3 Vacuum infiltration of tobacco leaves 32

II.2.10.4 Stable transformation of tobacco plants 32

Contents ___________________________________________________________________________

III

II.2.10.5 Growth of N. tabacum cv. Petite Havana SR1 33

II.2.10.6 Measurement of GUS activity and histochemical analysis 33

II.2.11 Expression and purification of recombinant proteins 34

II.2.11.1 Expression and purification of Forisome-GST fusion

proteins from E. coli 34

II.2.11.2 Fermentation at 4-liter scale 35

II.2.12 Protein analysis 36

II.2.12.1 Quantification of proteins 36

II.2.12.2 SDS-PAGE and Coomassie brillant blue staining 36

II.2.12.3 2D-PAGE analysis 37

II.2.12.4 Immunoblot analysis 38

II.2.13 Polyclonal antibodies production 38

II.2.13.1 Mouse immunization 38

II.2.13.2 Chicken immunization 39

II.2.13.3 Rabbit antisera 39

II.2.14 Determination of antisera titers 39

II.2.15 Confocal immunofluorescence microscopy 41

III RESULTS 41

III.1 Molecular characterization of Forisome genes 41

III.1.1 Analysis of isolated Vicia faba Forisomes by SDS-PAA

gel electrophoresis 41

III.1.2 Generation and characterization of Forisome-specific

polyclonal antibodies 41

III.1.2.1 Immunoblot analysis of isolated Vicia faba Forisomes 41

III.1.2.2 Immunoblot analysis of isolated Vicia faba Forisomes

on 2D-gel electrophoresis 42

III.1.3 Screening of cDNA Libraries 43

III.1.4 Immunoscreening of cDNA expression library 45

III.1.5 PCR screening of cDNA expression library 46

III.1.6 Cloning full-length Forisome cDNA 46

III.1.7 Isolation of total RNA from Vicia faba 51

III.1.8 Identification of the transcription start sites for vff1 52

III.1.9 Molecular characterisation of the vff1 genomic clone 53

Contents ___________________________________________________________________________

IV

III.2 Molecular cloning and characterization of the vff1 promoter 54

III.2.1 Construction of genome walking libraries 54

III.2.2 Identification and cloning of vff1 gene 5-flanking region 54

III.2.3 Potential regulatory sequences in the vff1 promoter 56

III.2.4 Characterization of vff1 promoter in transgenic tobacco 58

III.2.4.1 Cloning of vff1 promoter into the pTRAk-GUS vector 58

III.2.4.2 Expression of vff1 Promoter-GUS fusions in tobacco

plants 60

III.2.4.2.1 Tissue specificity of vff1 promoter in transgenic

plants 60

III.2.4.2.2 Developmental regulation of vff1 promoter in

transgenic plants 63

III.2.4.3 Deletion analysis of vff1 promoter in transiently

transformed tobacco leaves 65

III.3 Bacterial expression and characterization of VFF1 66

III.3.1 Cloning of vff1 into the bacterial expression vector

pGEX-5X-3 66

III.3.2 Bacterial expression and purification of VFF1 66

III.3.3 Characterization of GST-VFF1 fusion protein by

immunoreativity toward Forisome-specific mouse and

chicken antisera 68

III.4 Immunological characterization of native and recombinant

Forisomes 70

III.4.1 Reactivity of polyclonal anti-GST-VFF1 antibodies to isolated

Forisomes 70

III.4.2 Characterization of native Forisomes by immunofluorescence 71

III.4.2.1 Reactivity of Forisome-specific polyclonal antibodies to

native Forisomes 71

III.4.2.2 Reactivity of VFF1-specific polyclonal antibodies to native

Forisomes 73

IV DISCUSSION 75

IV.1 Molecular characterization of Forisome genes 75

IV.1.1 Analysis of Vicia faba Forisome subunits 75

Contents ___________________________________________________________________________

V

IV.1.2 Cloning and characterization of vff1 gene 76

IV.1.2.1 Screening of cDNA libraries 76

IV.1.2.2 Database search and cloning of vff1 gene 78

IV.1.2.3 Sequence analysis of vff1 gene 78

IV.1.2.4 Motifs identified within the vff1 gene 79

IV.1.3 Immunological evidence of vff1 gene encoding a Forisome

protein 82

IV.1.3.1 Expression and purification of recombinant VFF1

protein 82

IV.1.3.2 Immunoreactivity of Vicia faba Forisome-specific

polyclonal antibodies to recombinant VFF1 proteins

and native Vicia faba Forisomes 83

IV.1.3.3 Immunoreactivity of VFF1-specific polyclonal antibodies

to recombinant VFF1 proteins and native Vicia faba

Forisomes 84

IV.2 Molecular characterization of vff1 promoter 85

IV.2.1 Sequence analysis of vff1 promoter 85

IV.2.2 Phloem-specific expression pattern driven by vff1 promoter 86

IV.2.3 Differential expression pattern driven by vff1 promoter in the

sieve element-companion cell complex 88

IV.2.4 Developmental expression pattern of vff1 promoter in different

maturation stages 90

IV.2.4.1 Vff1 promoter expression pattern in roots of N. tabacum 90

IV.2.4.2 Vff1 promoter expression pattern in leaves of N. tabacum 91

IV.2.5 Vff1 promoter activation during the sink-source transition 92

IV.2.6 Vff1 promoter expression induced upon wounding 93

IV.2.7 Deletion analysis 94

IV.3 Conclusion and future prospects 95

V SUMMARY 97

VI REFERENCES 99

VII APPENDICES 116

VII.1 List of abbreviations 116

Contents ___________________________________________________________________________

VI

VII.2 Schematic presentation of vectors maps 119

VII.3 Figures 121

VII.4 Tables 122

Chapter I Introduction ___________________________________________________________________________

1

I Introduction

I.1 Phloem structure and function

In higher vascular plants, phloem is a highly specialized tissue for long distance transport of

metabolites and signaling components. In contrast, water and inorganic nutrients flow from

roots to shoots and leaves in the xylem. Topologically, xylem flux takes an apoplastic, i.e.,

extracellular path, as the xylem vessels consist of the lignified walls of dead cells. On the

other hand, products of photosynthesis travel from source to sink tissues in the sieve tubes of

the phloem, following a symplastic pathway (Behnke and Sjlund, 1990). Moreover, a wide

variety of other material is also transported through the phloem, including proteins, amino

acids, solutes, viruses, and various signaling molecules.

Sieve tubes consist of sieve elements (SEs), terminally differentiated cells that undergo

exceptional cytoplasmic reorganization to become functional phloem conductive cells capable

of long-distance translocation. Mature sieve elements are characteristically devoid of most of

the intracellular organelles, nuclei, central vacuole, Golgi bodies and dictyosomes (Oparka

and Turgeon, 1999; Cronshaw, 1981) as well as most of the ribosomes and microtubules that

are lost during the course of differentiation (Sjlund, 1997). Microfilaments also vanish

during sieve element maturation (Parthasarathy and Pesacreta, 1980). Reorganization of the

endomembrane system results from degeneration of the tonoplast and dictyosomes and

changes in the endoplasmic reticulum (Sjlund and Shih, 1983).

Having a common boundary, arranged end-to-end sieve elements develop numerous pores in

the cell walls between them. Plasmodesmata (PD) connecting SEs across the end walls

become greatly modified giving rise to the sieve plates that are characteristic of this tissue

(Behnke, 1989). Sieve plates ensure cytoplasmic continuity of the entire sieve-tube network,

enabling pressure-driven mass flow throughout the plant body (Knoblauch and van Bel, 1998;

van Bel et al., 2002). According to the mass flow concept of phloem transport (Mnch, 1930),

the transport of materials through phloem sieve tubes is passive, nonselective, and driven

entirely by pressure gradients that are maintained by active loading of photosynthetic products

in source tissue and unloading of materials in sink tissue.

I.1.1 Sieve element-companion cell complex

After the first description of the SE by Hartig (1837) the typical sieve element/companion cell

complex of the phloems, became center of numerous investigations. Typically, each sieve

element in angiosperms is accompanied by one or more companion cells (CCs), which

interact intimately with the sieve element and play a crucial role in regulating phloem loading

and unloading and in the turnover of sieve element proteins and other components (Oparka

and Turgeon, 1999). Sieve elements and companion cells are derived from unequal


2

longitudinal division of a single fusiform mother cell (Esau, 1969). During the course of

differentiation, cytoplasmic degeneration include a disintegration of the nucleus together with

the loss of ribosomes which hinders its protein biosynthesis (Thompson and Schulz, 1999).

Thus, the cell that becomes the sieve element, gradually lose genetic and metabolic control.

As a consequence, these elongated conducting elements of the phloem, the SEs, become

intimately (structurally, developmentally, and functionally) associated with adjacent

companion cells between which are capable of exchanging information via specialized pore

plasmodesmata units (PPUs; van Bel and Kempers, 1996). These PPUs are different from

other plasmodesmata. The lateral (axial) plasmodesmata that connect the SE and CC (PPUs)

are always branched on the CC side of the shared wall only, thereby comprising one broader

pore-like channel at the sieve element side while several narrower branching out at the

companion cell side (Esau and Thorsch, 1985). The PPUs form a continuity between the sieve

element plasma membrane and that of the companion cell, hence, connecting their

cytoplasms. Because of these intimate structural and functional connections between SE and

CC, the SE-CC complex is frequently viewed as a single functional entity within the phloem.

During the differentiation of phloem sieve elements, the endoplasmic reticulum undergoes

unique modifications to form the sieve element reticulum (SER; Sjlund and Shih, 1983)

which persists in mature, functioning sieve tubes. Cisternae of the SER lack ribosomes and

are restricted to the periphery of the sieve element at late stages of development. Some of the

SER are seen as single cisternae in close contact with the sieve element plasma membrane.

Probably the companion cell ER is also in contact with the sieve element reticulum held

together by the PPUs. Both the PPUs and the SER possibly ensure the protein transport of the

companion cell to the sieve element (Fisher et al., 1992; Imlau et al., 1999).

I.1.2 P-Proteins and regulation of phloem transport

More than a hundred proteins were detected in phloem exudates of Cucurbita maxima,

Triticum aestivum, Ricinus communis and Oryza sativa (Eschrich and Heyser, 1975; Fisher et

al., 1992; Nakamura et al., 1993; Sakuth et al., 1993). These phloem proteins were considered

to maintain the physiological functions of sieve tubes, such as sieve plate occlusion, signal

transduction, redox regulation, and phloem loading, among others (Hayashi et al., 2000).

Mature sieve elements retain a modified endoplasmic reticulum (ER), mitochondria,

numerous types of proteins, and specialized sieve element plastids. Most of these components

are arranged along the lateral walls of the sieve element and collectively constitute a system

known as the parietal layer (Ehlers et al., 2000). Based on electron micrographs and

descriptions of plastids from the sieve elements of many different species, two types of sieve

element plastids are distinguished (Behnke, 1991a). S-type plastids contain only starch

inclusions, while P-type plastids contain mainly protein inclusions along with some starch

inclusions. Furthermore, crystalloid proteins were present in these sieve elements. Behnke


3

(1991b) referred to nondispersive versus dispersive protein bodies, also called P-proteins

or structural sieve element proteins. These terms arose because of changes that are observed

during sieve element ontogeny. Early in the maturation process, many protein bodies are often

observed, some of which disperse as the sieve element matures and some that remain

unchanged in mature sieve elements. Early stages of sieve element differentiation are

characterized by the appearance of structurally distinct cytoplasmic proteins, in reference to

the P-proteins. Ultrastructural investigations originally defined P-proteins as idiosyncratic

components of the structural architecture of sieve elements (Cronshaw and Esau, 1967).

Depending upon the plant species, P-proteins form fibrillar, tubular, or crystalline inclusions

whose accumulation and structural state appear to be strictly controlled during differentiation.

Figure I-1 In vivo structure of sieve elements in Vicia faba (Knoblauch and van Bel, 1998). Sections of two sieve tubes with CCs, mostly in staggered position are depicted. SEs and CCs are mostly connected through numerous pore plasmodesma units. P-plastids, mitochondria, and ER are parietally positioned and evenly distributed. Parietal proteins are locally aggregated. Parietal proteins and ER are sometimes located on the sieve plates or the margins of the sieve pores but do not impede mass flow. A large spindle-shaped crystalline protein cluster rests close to the sieve plate. The massive protein body is a specialty of the Fabaceae. C, callose; CC, companion cell; CP, crystalline protein body; CW, cell wall; ER, endoplasmic reticulum; M, mitochondria; N, nucleus; P and Pl, plastids; PP, parietal protein; PPU, pore plasmodesma unit; SE, sieve element; SP, sieve plate; V, vacuole.

There are many shapes of non-dispersive fibrous and crystalloid protein bodies, also called P-

proteins, which may be quite large and are often observed in the lumen of sieve elements

(Figure I-1). Electron micrographic images sometimes show masses of fibrous or amorphous

protein located directly in front of or within the pores of sieve plates and that appear to block

transport through the pores. To date, the large crystalloid P-protein bodies that occur

exclusively in Fabaceae were classified as being non-dispersive (Behnke, 1991b).

Confocal laser scanning microscopy (CLSM) allowed the direct visualization of fluorescent

dyes moving in sieve tubes of V. faba (Knoblauch and van Bel, 1998), which provided

definitive evidence of unimpeded mass flow in intact plants. This study also reported that P-


4

type plastids in V. faba actually exploded upon injury of sieve elements, releasing their

protein contents, which, together with the dispersed crystalloid protein, rapidly occluded the

sieve plate pores. Furthermore, it was observed that crystalloid P-proteins of V. faba rapidly

disperse and occlude sieve plate pores after injury or osmotic shock (Knoblauch et al., 2001).

This process is rapidly reversible and controlled by calcium fluxes. Protein from the large

crystalloid protein bodies in V. faba sieve elements dispersed to plug the sieve plate pores

after injury from micropipette injection (Figure I-2) or osmotic shock induced by various

osmolytes.

Figure I-2 Conformational change of crystalline P-protein bodies in Vicia faba as a response to injury (Knoblauch et al., 2001). Crystalloid P-protein bodies were observed in CDMFDA-stained phloem tissue of broad bean (V. faba) by CLSM. (A) Condensed conformation before insertion of a micropipette (not visible; tip diameter of 2 mm). (B) Dispersed conformation after injury. Micropipette insertion triggers the transformation of the dense, elongate crystalloid into a sieve tube plug. Asterisks, crystalline P-protein bodies; CC, companion cell.

Addition of the chelating agent EDTA completely prevented crystalloid P-protein dispersal,

and repeated exchanges of Ca2+ and EDTA-containing media induced the alternate dispersal

and reassembly, respectively, of crystalloid P-proteins in injured sieve tubes. Furthermore, it

was also observed that the Ca2+ response could be mimicked partly by unphysiological pH

values (Knoblauch et al., 2003). Plugging of sieve plates to maintain turgor pressure within

the sieve tube after injury to a sieve element is the most generally accepted role for these

proteins, although other functions in pathogen and pest defence have been proposed (Read

and Northcote, 1983).

It has been suggested that not only these crystalloid P-proteins but also P-protein originating

from all sources within V. faba sieve elements (e.g., P-plastids, parietal proteins, and larger

crystalloid P-proteins) takes part in the occlusion of sieve plate pores after injury to cells

(Knoblauch and van Bel, 1998). Moreover, proteins in V. faba are much more sensitive to

perturbation than are the P-type plastids. Unlike the reversibility of crystalloid protein

dispersal, explosion and dispersal of the P-type plastids appears to be irreversible. Dispersal


5

of parietal proteins after injury has also been observed and was found to be more sensitive to

perturbation than was the explosion of P-type plastids (Knoblauch and van Bel, 1998).

P-protein, as a structural entity, has been observed in sieve elements of all dicotyledons

examined (Evert, 1990) and in the majority of monocotyledons, although conspicuously

absent in families such as the Poaceae (Eleftheriou, 1990). The lack of P-protein also appears

to be a consistent feature of gymnosperms (Schulz, 1990) and seedless vascular plants.

Large crystalloid P-proteins are a particular characteristic of the Fabaceae (legumes). Analysis

sieve elements of Urtica dioica (Urticaceae) and Rubus fruticosus (Rosaceae) in response to

wounding showed that the P-protein bodies present in these species failed to disperse and

occlude sieve pores, even when severely damaged in the presence of free Ca2+. P-type plastids

also appear to have somewhat limited distribution. Proteinaceous P-type plastids were

observed in just 64 of 382 dicot families studied by Behnke (1991a); the majority of families

contained starch-filled S-type plastids.

I.1.3 Forisomes

The conformational regulatory properties of the crystalline P-proteins in Vicia faba sieve

elements are the most remarkable in the field of long-distance transport in plants. Their

reversible change between a dispersed and a condensed condition adjusts the permeability of

the sieve plates and disposed the authors to give to these protein bodies the name Forisome

(lat. foris: gate, greek soma: body; Knoblauch et al., 2003).

In contrast to P-plastids that are long-establish organelles in the SEs of dicotyledons (Bhenke,

1981), Forisomes are not organelles in the strict sense, as they are not separated from the

cytosol by a membrane (Knoblauch and Peters, 2004). In vivo studies using a transient

fluorescence dye on the dispersed conformation adopted by the Forisomes (Knoblauch et al.,

2001) evidenced the presence of a distinctive protein body instead of a complete dissolution

into unordered fibrils observed by electronmicrographs. This implies that Forisomes consist

of fibrils that are organized quite differently in the condensed (longitudinally expanded) and

the dispersed (longitudinally contracted) state, however, held together after the induced

conformational change. In the latter, the fibrils form an irregular, loose network.

In addition, electronmicrographs of condensed Forisomes showed longitudinally arranged

fibrils with a perfectly regular perpendicular cross-striation (wavelength 12 to 15 nm)

(Knoblauch et al., 2001). This striation is always visible in longitudinal sections of expanded

Forisomes, regardless of the plane of section (radial or tangential). Therefore, the protein(s) in

expanded Forisomes must be organized in a series of transversal planes. The regular striation

pattern consistently has been found in earlier studies (Lawton, 1978a; Arsanto, 1982), and the

disordered appearance of Forisomes in the plug-forming state was documented as well.

Lacking any knowledge of the dynamics of Forisomes, these two conditions had been


6

interpreted as different stages of sieve element differentiation (Wergin and Newcomb, 1970;

Palevitz and Newcomb, 1971; Arsanto, 1982), or as preparation artefacts of little

physiological significance (Fisher, 1975; Lawton, 1978b). However, in the context of recent

findings (Knoblauch and Peters, 2004), available ultrastructural data rather seem to document

a remarkable example of rigorously regulated, rapid, and reversible molecular self-assembly.

The parallelization of fibrils and the establishment of the perpendicular striation during

Forisome expansion point to a lateral co-alignment of at least two types of structural domains

that alternate on each fibril. These domains might differ in physicochemical parameters such

as hydrophobic or electrical charge patterns, causing them to organize in alternating planes

that are oriented normal to the Forisome axis. If so, fibril co-alignment might actually play a

role in driving Forisome expansion. A paradigmatic example of such a process can be found

in nematode sperm cells, in which pH-controlled lateral interactions between MSP (major

sperm protein) subfilaments initiate the assembly of MSP filaments and filament bundles.

Notably, the reversible lateral coalignment of MSP filaments appears to provide the driving

force for nematode sperm motility (Bottino et al., 2001).

Further in vitro studies in Forisomes isolated from individual cells by micro-dissection

indicated that Ca2+ above a threshold of less than 100 nM induces a reversible doubling of

Forisome diameter and a reduction of Forisome length by almost one third (Knoblauch et al.,

2003). This anisotropic response results in a decrease of aspect ratio from 10 to 3 combined

with a more than threefold volume increase, which is the geometric basis for sieve tube

plugging. Contraction/expansion cycles can be induced in vitro by exchanging the incubation

medium. Therefore, no soluble factors are required for Forisome action, implying also that

reversible depolymerization, an important mechanism of motility in many cell types

(Mogilner and Oster, 2003), does not occur. Both Ca2+-induced contraction and chelator-

mediated expansion can be completed in less than 0.1 sec. Forisomes can be fixed between

pairs of glass fibers to form Forisome-powered micro-forceps. In such setups, they develop

forces of up to 0.1 N in both contraction and expansion (Knoblauch et al., 2003).

Calcium is an important component of many signal transduction pathways, and calcium

regulation has been implicated in phloem function. Knoblauch et al. (2001) showed that an

influx of calcium into legume sieve elements stimulates the rapid and reversible dispersal of

crystalloid P-protein to occlude sieve plate pores. The concentration of free calcium in sieve

tubes of R. communis has been found to be significantly higher than that in surrounding tissue

(Brauer et al., 1998), and calcium-dependent protein kinases have been detected in rice

phloem sap (Nakamura et al., 1993). Volk and Franceschi (2000) showed evidence of a

calcium channel in the sieve element plasma membrane of tobacco and of the aquatic plant

Pistia stratiotes using immunolabeling with antibodies to a calcium channel protein. These

authors proposed that calcium channels become activated during wounding or pathogen

attack, facilitating calcium influx into phloem tissues. McEuen et al. (1981) detected a


7

calcium binding protein distinct from calmodulin in phloem exudates of C. maxima and

speculated that it might be associated with P-protein function.

On the other hand, given that in general the presence of ATP is a requirement for the majority

of motor-like biomolecules, it become evident that Forisomes might represent a previously

unknown class of mechano-proteins since their reversible conformational change is not driven

by ATP but energized by changes of the free Ca2+ concentration or pH variations. ATP-driven

motor proteins, the actuator of living cells, possess promising characteristics in micro- and

nanodevices, however, their dependence on a strictly defined chemical environment can be

disadvantageous. ATP-independency, together with a periodic reversible motion, are difficult

properties to ascertain. These two remarkable features are found in Forisomes, making them

one of the most promising proteins in the field of biomimetic engineering.

The wide range of applications for biomimetic smart materials underscored the need for the

molecular and biological investigation of the Forisome described in the available work.

I.1.4 Ca2+-binding motifs and secondary protein structures

I.1.4.1 EF-hand

The EF-hand is the most frequent motif found in Ca2+-binding proteins (Nakayama and

Kretsinger, 1994; Muranyi and Finn, 2001). The EF-hand family is a large class of Ca2+-

binding proteins that contain homologous Ca2+-binding sites within a characteristic helix-

loop-helix motif (da Silva and Reinach, 1991; Kawasaki and Kretsinger, 1994; Falke et al.,

1994; Chazin, 1995). EF-hands are generally found back-to-back in anti-parallel pairs with -sheet-like hydrogen bonding occurring between the loops of the coupled sites. These coupled

sites are often found to have cooperative metal ion binding, as in the case of calmodulin.

Within this characteristic helix-loop-helix motif, the Ca2+ is enclosed in the loop between two

-helices, in a pentagonal, bipiramidal configuration.

Proteins containing the EF-hand Ca2+-binding motif, such as calmodulin and calcineurin B,

function as regulators of various cellular processes that are sensitive to Ca2+ (Nakayama and

Kretsinger, 1994; Kawasaki and Kretsinger, 1995; Ikura, 1996; Polans et al., 1996; Schafer

and Heizmann, 1996). Many essential cellular processes, such as cell cycle control, nucleotide

metabolism and signal transduction, are tightly regulated by calcium. In certain Ca2+-binding

proteins, regulatory domains undergo large conformational changes upon ion binding, and

this response modulates their overall intramolecular conformation and their interaction with

other proteins, including aggregation and dissociation (Rashidi, H.H. et al., 1999; Nakashima,

K. et al., 1999; Pal, G.P. et al., 2001).

Despite the dominance of the EF-hand motifs, other known Ca2+-binding motifs (Muranyi, A.

and Finn, B.E., 2001; Swairjo, M.A. and Seation, B.A., 1994; Nalefski, E.A. and Falke, J.J.,

1996; Rizo, J. and Sdhof, T.C., 1998; Weis, W.I., 1996) are found in Ca2+-binding proteins.


8

I.1.4.2 Coiled-coil domains

The rodlike -helical coiled-coil is one of the simplest yet most common structural motifs occurring in proteins. Consisting of two to five -helices twisted into a left-handed supercoil, the occurrence of this structure is well documented, occurring in a wide variety of proteins

including motor proteins, DNA binding proteins, extracellular proteins, and viral fusion

proteins (Lupas, 1996; Kohn et al., 1997; Burkhard et al., 2001). The presence of a

continuous interface of hydrophobic amino acids along the length of the helices provides a

major source of stability to the fold as the hydrophobics pack in a knobs-into-holes fashion

shielded from the bulk solvent (Crick, 1953). The pattern of repeating hydrophobic residues at

positions a and d of the heptad repeat (denoted abcdefg) that are responsible for coiled-coil

formation was first identified by Hodges et al. (1972) from the amino acid sequence of

tropomyosin. Later, a dimerization domain of a family of transcription factors, the leucine

zipper (Landschulz et al., 1988), was also described comprising this structural motif.

Figure I-3 Structures of parallel coiled coils (Mller, K.M. et al., 2000). (A) Helical wheel diagram of a parallel, dimeric coiled coil illustrating the disposition of the characteristic heptad repeat. (B-C) X-ray crystal structures of dimeric and trimeric GCN4 leucine zipper variants. The backbone and interface residues are shown superimposed on the ribbon representation of the helices.


9

The coiled-coil domain is responsible for oligomerization of protein subunits and concomitant

folding of the proteins. The versatility of coiled coils for oligomerization derives from their

diversity of oligomeric structures. Coiled coils are gently twisted, ropelike bundles containing

two to five -helices in parallel or antiparallel orientation. The N and C termini of the helices are easily accessible, facilitating linkage to other proteins. Parallel dimers and trimers are by

far the most commonly observed coiled coils (Figure I-3).

I.2 Promoter sequences and regulation of transcription

The regulation of gene expression at the level of transcription is a key control point affecting

gene expression in response to a variety of extra- and intracellular signals, during

developmental processes and for tissue specificity. In eukaryotes, there are tens of thousands

of protein-coding genes, each of which has its unique program of transcription. The cis-acting

DNA sequences that encode these transcriptional programs include transcriptional enhancers,

proximal promoters, and core promoters also called minimal promoters. A typical eukaryotic

promoter consists of a minimal promoter and upstream cis-elements. The minimal promoter is

essentially a TATA box, an A/T-rich region located about 30 nucleotides (nt) upstream of the

transcription start site where RNA polymerase II, TATA-binding protein (TBP), and TBP-

associated factors (TAFs) bind to initiate transcription. However, minimal promoters alone

have no transcriptional activity. The cis-elements, to which tissue-specific or development-

specific transcription factors bind, individually or in combination, determine the spatio-

temporal expression pattern of a promoter at the transcriptional level. Enhancers and proximal

promoters are recognized by sequence-specific DNA-binding proteins that regulate

transcription (Blackwood and Kadonaga, 1998; Lee and Young, 2000; Lemon and Tjian,

2000; Malik and Roeder, 2000). Enhancers are often located many kilobase pairs (kbp)

upstream or downstream of the transcription start site, whereas proximal promoters are

typically within a couple hundred base pairs (bp) of the start site. Core promoters encompass

the transcription start site and specify the site of transcription initiation by the basal

transcriptional machinery (Orphanides et al., 1996; Smale, 1997; White, 2001). The core

promoter is at a unique and important position in the transcription process, as it is the eventual

target of the action of the many sequence-specific factors and co-regulators that control the

transcriptional activity of each gene.

I.2.1 Phloem-specific promoters

Regulation of transcription is achieved by the activity of multiple proteins that bind to

regulatory elements, many of which are upstream of the promoters and alter basal rates of

transcription initiation and/or elongation (Roeder, R.G., 1991; Yankulov, K. et al., 1994). To

understand the mechanisms of tissue-specific and constitutive gene expression in plants, a


10

number of promoters and transcription factors have been studied in recent years (Benfey, P.

N. and Chua, N.-H., 1989; Leyva, A. et al., 1992; Fujiwara, T. and Beachy, R. N., 1994;

Suzuki, M, 1995; Faktor, O. et al., 1996; Yin, Y. et al., 1997b; Ringli, C. and Keller, B.,

1998; Niggeweg, R. et al., 2000). It was shown that constitutive promoters, such as the

Cauliflower mosaic virus 35S promoter (CaMV 35S; Odell et al., 1985), a double-stranded

DNA virus belonging to the Caulimoviridae family, and the promoter from Cassava vein

mosaic virus (CsVMV; Verdaguer, B. et al., 1998), a plant pararetrovirus from the

Caulimoviridae family, are modular in organization and multiple cis-elements. These

elements, with specific transcription factors, apparently interact in an additive and/or

synergistic manner to confer gene expression in all plant tissues. Similarly, tissue-specific

promoters contain multiple elements that contribute to promoter activity in both positive and

negative ways (Leyva, A. et al., 1992; Fujiwara, T. and Beachy, R. N., 1994; Suzuki, M. et

al., 1995; Ellerstrom, M. et al., 1996; Ringli, C. and Keller, B., 1998; Hauffe, K. D. et al.,

1993). Among tissue-specific promoters, several promoters from plants (Yang and Russell,

1990; Brears et al., 1991; DeWitt et al., 1991; Ohta et al., 1991; Martin et al., 1993; Hrouart

et al., 1994; Shi et al., 1994; Truernit and Sauer, 1995; Tornero et al., 1996), Agrobacterium

(Schmlling et al., 1989; Sugaya et al., 1989; Guevara-Garca et al., 1993) and viruses

(Medberry et al., 1992; Bhattacharyya-Pakrasi et al., 1993; Rohde et al., 1995) have been

reported to drive expression of reporter genes in the phloem of transgenic plants, thus

designated as phloem-specific promoters. These tissue-specific promoters include the

glutamine synthetase 3A (GS3A) gene promoter (Brears et al., 1991), the Arabidopsis H+-

ATPase isoform 3 (AHA3) gene promoter (DeWitt et al., 1991), the Agrobacterium rolC

promoter (Schmlling et al., 1989), the Arabidopsis sucrose synthase gene (Asusl) promoter

(Martin et al., 1993), the maize sucrose synthase-1 (Shl) gene promoter (Werr et al., 1985;

Yang and Russell, 1990) and the rice tungro bacilliform virus (RTBV) promoter

(Bhattacharyya-Pakrasi et aL, 1993; Yin and Beachy, 1995).

Brears et al. (1991) found that when the GS3A promoter is deleted to nucleotide -132 relative

to the transcriptional start site, it can still direct tissue-specific expression, and a 17 bp

imperfect palindrome was identified as a putative cis-element by virtue of the binding of a

nuclear protein complex (Brears et al., 1991). Later on, Hehn and Rohde (1998) identified a

phloem specific motif of 13 bp in length which has been described to be highly conserved

among four phloem-specific promoters, originating from a pea glutamine synthase gene

(GS3A), coconut foliar decay virus (CFDV), rice tungro bacilliform virus (RTBV), and an

Agrobacterium rhizogenes rolC gene as well as the a Robinia pseudoacacia inner-bark lectin

gene (Rplec2; Yoshida et al., 2002).

Furthermore, the rice tungro bacilliformbadnavirus (RTBV) promoter (Qu, R.D. et al., 1991;

Hay, J. M. et al., 1991) and the transcription factors that interact with it served as a model

system to study plant tissue-specific gene expression. The virus, which replicates solely in

phloem tissues, has a single promoter that is active in transfected protoplasts and is phloem-


11

specific in transgenic rice plants (Yin, Y. and Beachy, R. N., 1995; Yin, Y. et al., 1997a;

Chen, G. et al., 1994; Klti, A. et al., 1999). Within the promoter sequence, multiple cis-

elements, including motifs associated with tissue-specific expression like GATA box (Lam E

et al., 1989), were identified as being required for phloem-specific gene expression (Yin, Y.

and Beachy, R. N., 1995; Yin, Y. et al., 1997b; He, X. et al., 2000; Meisel, L. and Lam, E.,

1997). The GATA A(N)3GATA motif is known to be important for phloem-specific gene

expression not only from the rice tungro bacilliform virus RTBV promoter (Yin et al., 1997a)

but also the same motif was found in the promoters of GS3A (Brears et al., 1991), the

Arabidopsis plasma membrane H+-ATPase gene (AHA3; DeWitt et al., 1991), a potato

invertase gene (Hedley et al., 2000) and the Rplec2 (Yoshida et al., 2002).

The 13bp and GATA motifs are conserved between virus and plant promoters, implying an

important role for these motifs for gene expression in the phloem.

Here, the cloning of a promoter sequence for the vff1 gene encoding Forisomes in Vicia faba

is described, and its expression pattern using promoter-reporter fusion in transgenic plants

further analysed.


12

I.3 Aim of the thesis

The striking feature of Forisomes is the reversible and fast conformational change together

with their ATP-independency which make these structures interesting in the field of

nanotechnology biomaterials. Knoblauch et al. (2001) have reported that these conformational

changes are energized by modifications of the free Ca2+ concentration or pH variations.

Several other non-ATP based motors have been proposed, such as DNA-based nanoactuators

(Yurke, B. et al., 2000), flagella motors (Berg, H. C., 1974) and viral protein linear motors

(Dubey, A. et al., 2003). However, whereas all these have dimensions of the order of several

tens of nanometres, Forisomes are macroscopic assemblies whose size is in the order of

micrometers. Hence, although they could not be used to develop devices at the nanoscale,

they are easy to manipulate using current state-of-technology tools and their technological

readiness is therefore higher than that of other non-ATP-based motors.

Taken together, these unique characteristics of Forisomes built up the framework of this

thesis. Hence, the objective of the present study was to clone the gene/s encoding Forisomes

in Vicia faba and to identify specific calcium-binding motives. Subsequent recombinant

expression of the isolated gene/s with their concomitant molecular and biochemical

characterization were employed to confirm gene-struture-funtion relationships. Finally, the

promoter sequences regulating the expression of Forisome proteins were identified and

studied in greater detail.

A schematic overview of this thesis is presented in Figure I-4.


13

Generation and characterization of Forisome-specific

polyclonal Abs

Isolation of Vicia faba Forisomes

Peptides sequencing

Amplification of vff1 full-length cDNA and genomic sequence

Cloning of vff1 full-length cDNA in

bacterial expression vectors

Expression and purification of VFF1-

GST proteins

Generation and characterization of VFF1-GST-specific

polyclonal Abs

Immunological evidence of vff1 gene encoding a Forisome

protein

Amplification of vff1 promoter sequence

Cloning of vff1 promoter into plant expression vectors

Generation of transgenic

plants expressing GUS under control of

vff1 promoter

Differential expression pattern driven by vff1

promoter

Figure I-4 Schematic outline of the thesis

Chapter II Material and Methods ___________________________________________________________________________

14

II Material and Methods

II.1 Material

II.1.1 Chemicals and consumables

The chemicals used throughout the work were purchased from the following companies:

Amersham Bioscience (Freiburg, D), Axis-Shield PoC (Oslo, Norway), Boehringer

Mannheim (Mannheim, D), Duchefa (Haarlem, NL), Fluka (Neu-Ulm, D), Gibco BRL

(Eggenstein, D), Invitrogen (Karlsruhe, D), Merck (Darmstadt, D), Molecular Probes (Leiden,

NL), New England Biolabs (Frankfurt, D), Roche (Mannheim, D), Roth (Karlsruhe, D), Serva

(Heidelberg, D), and Sigma-Aldrich (Taufkirchen, D).

The consumables were from: Amicon (Witten), BioRad (Mnchen, D), Biozym (Hess.

Oldendorf, D), Eppendorf (Hamburg, D), Genetix (New Milton, UK), Greiner (Solingen, D),

Kodak (Stuttgart), MilliPore (Schwalbach, D), Qiagen (Hilden, D), Schleicher&Schuell

(Dassel, D), Whatman (Bender & Hobein, Bruchsal, D) and Zeiss (Oberkochem).

II.1.2 Enzymes and reaction kits

Restriction enzymes either from New England Biolabs (Schwalbach) or GibcoBRL were used

for DNA digestion. ExpandTM high fidelity DNA Taq polymerase from Roche or Advantage

2 Polymerase Mix from BD Biosciences Clontech were used for PCR amplification. TaqDNA

polymerase produced at the Fraunhofer IME (Aachen, D) was used for check-PCR

amplification.

The following kits were used:

Oligotex mRNA isolation kit from Qiagen,

QIAprep Spin Mini/Midiprep kit from Qiagen,

QIAquick gel extraction kit from Qiagen,

QIAquick PCR purification kit from Qiagen,

MinEluteTM PCR purification kit from Qiagen,

RNeasy mini kit from Qiagen,

SMART TM PCR cDNA Synthesis kit from BD Biosciences Clontech,

SMARTTM RACE cDNA Amplification Kit from BD Biosciences Clontech,

SUPERSCRIPTTM First-Strand Synthesis System for RT-PCR from Invitrogen,

Universal GenomeWalkerTM kit from BD Biosciences Clontech,

ECL Advance Western blotting detection kit from Amersham Biosciences,

Nucleon Phytopure Plant DNA extraction kit from Amersham Biosciences,

PCR-Select TM cDNA Subtraction kit from BD Biosciences Clontech.


15

II.1.3 Buffers, media and solutions

All standard solutions, buffers, and media were prepared according to Sambrook et al. (1989),

Ausubel et al. (1995) and Coligan et al. (1995). Compositions of otherwise special media and

solutions or buffers are listed at the end of the respective method section. Media for bacterial

and plant tissue cultures were sterilized by autoclaving (121oC/1-2 bar). Thermolabile

components were filter sterilised by passing through a 0.2 m filter (Millipore) and added to

the autoclaved media or buffer after they were cooled down to 60-50C.

II.1.4 Matrices and membranes

Glutathione sepharose 4B from AmershamPharmacia Biotech was used for purification of

GST fusion proteins (II.2.11).

HybondTM-C nitrocellulose membrane (0.45m) from Amersham Life Science and Whatman no.1 paper from Whatman (Maidstone, England) were used in immunoblot analysis

(II.2.12.4).

II.1.5 Primary antibodies, secondary antibodies and substrates

Mouse anti-GST monoclonal antibody provided by Dr. Michael Monecke (RWTH Aachen,

Institut fr Biologie VII, Germany) was used for analyses of GST and GST fusion protein

expression. Alkaline phosphatase (AP) or horseradish peroxidase (HRP)-conjugated to goat

anti-mouse IgG (H+L, Fc), rabbit anti-chicken (Fc) and goat anti-rabbit (Fc) (Dianova)

antibodies were used as secondary antibody in immunoblot analysis (II.2.12.4) and ELISA

(II.2.14). NBT/BCIP (BioRad) and pNPP (BioRad) or ABTS-H2O2 [0.5 mg of 2,2-azinobis

(3-ethylbenzthiazolinesulfonicacid) (ABTS)/ml, 0.002% H2O2, 0.1 M citrate-phosphate

buffer (pH 4.3)] were used as substrate for detection of immobilized proteins in immunoblot

(II.2.12.4) and ELISA (II.2.14), respectively.

Goat anti-mouse Alexa Fluor 488 (Molecular Probes) was used as secondary antibody in

immunofluorescence studies.

II.1.6 Biological material

II.1.6.1 Bacterial strains

E. coli strains DH5 and XL1-Blue were used as a host cells for all intermediate cloning

constructs. The strain BL21(DE3) was used for expression of VFF1-GST-fusion proteins

(II.2.11).


16

Agrobacterium tumefaciens GV 3101::pMP90RK (gentr, kanr), rifr (Koncz and Schell, 1986)

was used for Agrobacterium-mediated gene transfer into tobacco leaves (II.2.9) (Table II-1).

Table II-1 Name, suppliers and genotypes of bacterial strains used throughout this thesis

Strain Source Genotype

DH5 Ausubel et al., 1995 F- (f80d Lac 2M15) (LacZYA-argF) U169end A1 rec1 hsdR17(rk

- mk+) deoR thi-1

supE44 gyrA96 relA1 -

BL21(DE3) Novagen F- ompT hsdSB (rB mB -) gal dcm (DE3)

XL1-Blue Stratagene recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F proAB laclIq ZM15 Tn10 (Tetr)]

Agrobacterium Koncz and Schell, pMP90RK GmR, KmR, Rif R

tumefaciens 1986

GV 3101

II.1.6.2 Plants

Nicotiana tabacum L. cv. Petite Havana SR1 was used for transient protein expression after

vacuum infiltration of recombinant Agrobacteria (II.2.10.3) and for generation of stable

transformed plants (II.2.10.4).

II.1.6.3 Animals

6-8 weeks old female BALB/c mice as well as White Leghorn chicken about 12 weeks old

were used for immunization (II.2.13.1 and II.2.13.2) with isolated Forisomes from Vicia faba.

II.1.7 Vectors

II.1.7.1 Bacterial expression vector

pGEX-5X-3 from Amersham Pharmacia Biotech, modified at the multiple cloning site by

insertion of a NcoI site was used for subcloning the vff1 gene, together with partial fragments

(amino/carboxy terminus, center domains), and amplification of the resulting plasmids in E.

coli DH5. After confirmation of the DNA sequences, pGEX-VFF1 along with the plasmids harbouring the different protein domains were introduced into E. coli BL21 and expression of

the GST-fusion proteins was carried out.


17

II.1.7.2 Plant expression vectors

pUC103 - GUS (K. Fritze, MPIZ, Kln, Deutschland) containing the GUS-term construct

(III.2.4.1) was used for subcloning of the GUS-term reporter gene.

pTRA (Thomas Rademacher, Institut fr Biologie VII, RWTH Aachen, Germany) is a

optimized plant expression vector containing the Cauliflower mosaic virus (CaMV) 35S

promoter with duplicated enhancer region (35SS) or the phloem-specific promoter of the

Coconut foliar decay virus (CFDV) and the pA35S untranslated region from Cauliflower

mosaic virus (CaMV). A matrix attachment region was introduced to improve transcription.

This binary vector was used for subcloning the vff1 promoter (III 2.4.1) as well as series of

thirteen truncated vff1 promoter fragments (III 2.4.3) in replacement of the 35SS promoter.

Schematic presentation of the vector maps are presented in the Appendix VII.2.

II.1.8 Oligonucleotides

Oligonucleotides used for sequence analysis and amplification of DNA are listed below

(Tables II-2, II-3, II-4) . All oligonucleotides were synthesized by Metabion International AG

(Martinsried, Germany).

Table II-2 Primers used for PCR amplification in deletion analysis of vff1 Promoter in Vicia faba

forward f-P-pTRAk-1 5 -TTG GCG CGC CTT GAC TTG TAG ATA TGT TG- 3

f-P-pTRAk-2 5 -TGG GCG CGC CTC TAT AAA CGT TAA TGT TTG- 3

f-P-pTRAk-3 5 -TTG GCG CGC CTG AAA CAA CTC AAA CTT ATA- 3

f-P-pTRAk-4 5 -TTG GCG CGC CCA GTG GTG ACT CTT GCT ATC- 3

f-P-pTRAk-5 5 -TTG GCG CGC CCG GAT GAA AAT GGT ACT AAC- 3

f-P-pTRAk-6 5 -TTG GCG CGC CCT ACA TTC TCA ACG ATG CGA G- 3

f-P-pTRAk-7 5 -TTG GCG CGC CTT GTA TAC ATT CTC AAC GAT G- 3

f-P-pTRAk-8 5 -TTG GCG CGC CCA AAC ATT TTG TAT ACA TTC- 3

f-P-pTRAk-9 5 -TTG GCG CGC CAT ATA GTA CTA TCT AAA GG- 3

f-P-pTRAk-10 5 -TTG GCG CGC CTC CTC GAT GAC CCT TCA ATG- 3

f-P-pTRAk-11 5 -TTG GCG CGC CAT AAA ACA CTT TGC ACA CTT G- 3

f-P-pTRAk-12 5 -TTG GCG CGC CGT AAT AAC ATA TGA TAT TTA AA- 3

f-P-pTRAk-13 5 -TTG GCG CGC CAT TTC TCC TTC ATT TTT ATA TTT- 3

reverse r-P- pTRAk 5 -CAT GCC ATG GTG ACT CAA ATT TCA GAG AA- 3


18

Table II-3 Primers used for cDNA amplification in RACE-PCR

5-RACE-GSP1 5 -CTC ACC TCC ATC ACA CGT CCA CAA GTA GGA TTT GG- 3

5-RACE-GSP2 5 -ACT CTT CAA TGC TCT GAA CCG TTC CTT GCG GAT ATC GTC- 3

5-RACE-GSP3 5 -CAC AAT GGG GAT CCA CAA AAT CTT GAA GTC TTC TTT CTT- 3

5-RACE-GSP4 5 -TGG GCT TAT CGA AGA TCT TCC TGC GGT TAA ATA AAT CGT- 3

5-RACE-GSP5 5 -GGA ATT TCC AAT TGG GTC TGT TGC TGT GAC CCT ATT AAG T- 3

3-RACE-GSP1 5 -GGT GTA GAA AGG AAG AAA CAA AAC AAG AAG CAT CAA G- 3

Table II-4 Primers used for PCR amplification and subclone Vicia faba forisome cDNA, N-terminal, C-terminal and central domains

Namec Sequencea Product size (kb) b

vff1 fw: 5- CAT GCC ATG GGA ATG TCC TTT TCT AAC TCA -3 2.1

bw: 5- TAA AGC GGC CGC AAC ACC AAA GTT ATT TGG -3

N- vff1 fw: 5- CAT GCC ATG GGA ATG TCC TTT TCT AAC TCA -3 1.2

bw: 5- TAA AGC GGC CGC GTT CCT TGC GGA TAT CGT -3

M- vff1 fw: 5- CAT GCC ATG GGT TCC TTG AGA CAA CTG AAT -3 1.1

bw: 5- TAA AGC GGC CGC ACG TTT CAG AGT CTC GTG -3

C- vff1 fw: 5- CAT GCC ATG GGA TTC AGA GCA TTG AAG AGT -3 0.9

bw: 5- TAA AGC GGC CGC AAC ACC AAA GTT ATT TGG -3

a letters in bold represent restriction endonuclease sites (NcoI and NotI) introduced into each primer to allow efficient cloning of the PCR product into the appropriate vector. b The product size is that resulting from PCR using the matching set of sense and antisense primers with the corresponding template. c Designation of the oligonucleotide as fw indicates the sense primer, whereas bw indicates the antisense primer. vff1, N-vff1, C- vff1 and M-vff1 stand for full-lengh forisome cDNA, NH3-terminal, COOH-terminal and central-domains respectively.

II.1.9 Equipment and applications

BioBench stainless steel reactor (Applikon Dependable Instruments, Schiedam, The

Netherlands).

Biomek 2000 with 384 High Density Replica Tool (HDRT) (Beckmann Coulter, Fullerton,

US).

Cameras and scanner: MP4 (Polaroid, Cambridge, MA, USA). E.A.S.Y 429K camera

(Herolab, Wiesloch), Arcus II Scanner with AGFA FotoLook 3.5 Software (AGFA, Kln),

Fujifilm LAS-1000 (Fujifilm, Tokyo, Japan).


19

Centrifuges: AvantiTM 30, AvantiTM 20 and AvantiTMJ-25 (Beckman, California, USA),

Biofuge A (Heraeus, Hanau), Sigma 3-10 and Sigma 4-10 (Sigma, St. Louis, Missouri, USA),

RC5C and RC5B plus (Sorval instruments, Du Pont, Bad Homburg). Rotors: F0650, F2402H,

JLA 8.1000, JLA 10.500 and JA 25.50 (Beckman), #1140 and #11222 (Sigma), RLA-300,

SS-34 and GS-3 (Du Pont).

Confocal Fluorescence Microscope: Leica TCS SP (Leica, Wetzlar, Germany).

DNA gel electrophoresis apparatus: wide mini and mini cells for DNA agarose

electrophoresis and power supplies (BioRad).

DNA sequencer: ABI Prism 3730 DNA Analyzer and BigDyeTM cycle sequencing

terminator chemistry apparatus (Applied Biosystems, Foster, CA, USA).

Electroporation apparatus: Gene pulserTM, Pulse controller unit, Extender unit

(BioRad) and 0.2 cm cuvettes (BioRad).

Fluorescent Image Analyzer: Phosphorimager FLA-3000 (Fujifilm, Tokyo, Japan).

InnovaTM 4340 incubator shaker (New Brunswick Scientific, Nrtingen).

Light Microscope: Leica DMLFS (Leica, Wetzlar, Germany) with a JVC camera TK-C1360

(Tokio, Japan).

PCR Thermocyclers: Primus and Primus 96 plus (MWG-Biotech).

Photometer: Eppendorf biophotometer with Printer DPU 414 (Eppendorf, Hamburg), and

multi-channel spectrophotometer Spectromax 340 (Molecular Devices, Sunnyvale,

California).

Probe sonicator: Bandelin Sonoplus sonicator UW2070 with Titan Microtip MS72

(Bandelin Electronic, Berlin).

Protein gel electrophoresis and electroblotting equipment: Mini-PROTEAN IIITM

electrophoresis system (Bio-Rad), Mini Trans-Blot Cell (Bio-Rad), Gel Air, Dryer (Bio-Rad).

QPix picking/gridding robot (Genetix, New Milton, UK)

Software: Windows NT 4.0 operating system (Microsoft); Microsoft Office 2000

(Microsoft); Adobe Photoshop 6.0 (Adobe); Chromas; Origin 6.0 (Data analysis and technical

graphics, Microcal Software, Inc.); Align IR, version 1.2 (LI-COR); GCG (Wisconsin

Package v10.2 TM, Genetic Computer Group Madison, Wisc.).

Speed-Vac centrifuge: Eppendorf Concentrator 5301 (Eppendorf)

UV-Transilluminators: wavelength 302 nm and UVT-20M (Herolab). UV-chamber (Bio-

Rad).

Vibrating-blade Microtome: Leica VT 1000S (Leica Microsystems Wetzlar GmbH,

Germany).


20

II.2 Methods

All experiments related to the genetic engineering were performed according to the

regulations of S1-Richtlinien and were officially approved by the Regierungsprsidium des

Landes NRW (RP-Nr.: 23.203.2 AC 12, 21/95) and BGA [AZ 521-K-1-8/98:AI3-

04/1/0866/88 (S1) and 55.8867/-4/93 (greenhouse)].

General recombinant DNA techniques, i.e. PCI (phenol/chloroform/isoamyl alcohol) and CI

(chloroform/isoamyl alcohol) extraction, DNA precipitation, restriction enzyme digestion,

DNA ligation, DNA agarose gel electrophoresis, were performed according to the standard

protocols described in Sambrook et al. (1989) and Ausubel et al. (1995).

II.2.1 Plant material and isolation of Forisomes

Vicia faba L. cultivar Witkiem major (Nunhem Zaden, Haelen, The Netherlands) were grown

in a greenhouse at 20 C and a 14/10 h light/dark period (daylight plus additional lamp light).

The first three internodes of up to 60 plants were excised 6 weeks after germination. The rind

was pulled off the central wood cylinder in two strips; the phloem tissue was then scratched

off these strips with scalpels and transferred to Ca2+-free medium (50 mM KCl, 10 mM, 10

mM of either HEPES or Tris/HCl, pH 7.3). The collected tissue was frozen in liquid nitrogen,

homogenized in a mortar, thawed in Ca2+-free medium, and passed through a 60-m-mesh

filter. The filtrate was centrifuged at 2,500g and 20 C for 30 min. The pellet was resuspended

in 11.25 ml Ca2+-free medium and 3.75 ml of an 80% Nycodenz (Axis-Shield PoC, Oslo,

Norway) solution were added. Using another 15 ml of the Nycodenz solution, a density

gradient (20 to 80% Nycodenz) was produced with a custom-built gradient mixer. The

gradient was centrifuged at 150,000g and 20 C for 3 h in an ultracentrifuge (OTD75B

Sorvall, Wilmington, Delaware, USA). Forisomes accumulated in a layer corresponding to

roughly 1.2 gml1. This layer was extracted and washed by adding a threefold volume of Ca2+-

free medium. The sample was centrifuged at 2,500g and 20 C for 30 min, and the pellet

containing the Forisomes was resuspended in a small volume of medium. With the aim of

avoiding the presence of membrane-bound proteins, which normally contaminate the isolation

of Forisomes, the sample was washed two times by adding a threefold volume of 1 mM Na2-

EDTA, 0,1% (v/v) Triton X-100 medium. The sample was centrifuged at 2,500g and 20 C

for 10 min after each washing step and the pellet was resuspended in 500 l of 1xPBS.

II.2.2 Peptides sequencing

A sample of the isolated Forisomes was separated by SDS-PAGE (sodium dodecyl sulfate-

polyacrylamide gel electrophoresis; II.2.12.2). Coomassie blue staining demonstrated two


21

predominant bands migrating at ~ 70kDa. These bands were excised from the gel, digested

with trypsin and analyzed by peptide mass fingerprinting following nanoLC-ESI-MS/MS and

MALDI-TOF-MS. Peptide sequencing was done by different companies (Proteome Factory

AG, Berlin; TopLab, Munich; Fraunhofer IME, Aachen) and the sequences obtained were

subject to comparison against a Medicago truncatula public EST data base (http://medicago.

toulouse.inra.fr/Mt/EST).

II.2.3 Isolation of genomic plant DNA

Genomic DNA was isolated from young Vicia faba leaves using the Nucleon Phytopure Plant

DNA extraction Kit (Amersham).

II.2.4 RNA isolation

Total RNA was isolated from a powdered pool of young leaves and stems using hot borate

method with modifications, as described by Moser et al. (2004). 1g of the plant tissue was

extracted in 3.5 ml of pre-warmed (80C) RNA extraction buffer. The homogenate was mixed

thoroughly, incubated at 80C for 5 min and then distributed in 2 ml microcentrifuge tubes

(1.4 ml of sample per tube). To inactivate contaminating ribonucleases, 1 mg of proteinase K

(2.2 mg of proteinase K for 1 g of tissue) was added following incubation at 42C for 1 h.

After adding 2 M KCl to final concentration of 160 mM, the samples were kept on ice for 45

min. The samples were centrifuged at 13,000 rpm at 8C for 15 min to enable pelleting of

insoluble particulates. The supernatant was then transferred to a new 2 ml microcentrifuged

tube, where 8 M LiCl to a final concentration of 2 M was added to allow RNA precipitation.

The samples were incubated on ice at 4C overnight. The precipitated RNA was obtained by

centrifugation at 13,000 rpm at 8C for 25 min. After discarding the supernatant, the RNA

pellet was washed with 1 ml of ice cold 2 M LiCl and then centrifuged at 13,000 rpm and 8C

for 15 min. The RNA pellet was then resuspended with 600 l of 10 mM Tris-HCl (pH 7.5)

and mixed thoroughly at room temperature. For removal of polysaccharides, 1/10 vol. of 2 M

potassium acetate (pH 5.5) was added to each sample following incubation for 10 min on ice.

The samples were centrifuged at 13,000 rpm and 8C for 15 min. The supernatant was

transferred into new 1.5-ml microcentrifuge tubes, mixed with 0.9 vol of cold (4C)

isopropanol and then stored at -20C for 1 h to allow RNA precipitation. As a final step, the

RNA precipitate was centrifuged at 13,000 rpm and 8C for 25 min. After washing the

obtained RNA pellet with 1 ml of cold (4C) 80% (v/v) ethanol and centrifugation at 13,000

rpm and 8C for 10 min, the samples were dried out in ice under sterile flow cabinet. The

RNA was resuspended in 30-50 l of RNase-free water, pooled together in a new 1.5-ml

microcentrifuge tube and stored at -80C. The mRNA was isolated using the Oligotex mRNA

isolation kit (Qiagen USA, Valencia, CA).


22

RNA extraction buffer: 0.2 M sodium tetraborate decahydrate, 0.03 M EDTA (pH 8.0), 1%

(w/v) SDS, 1% (w/v) deoxycholate acid sodium salt, 2% (v/v) -mercaptoethanol, 0.5% (w/v) spermidine, 2% (w/v) PVP (mol wt

40000), 1% (w/v) IGEPAL.

II.2.5 Libraries construction and screening strategies

II.2.5.1 cDNA expression library

A custom cDNA Expression Library of Vicia faba plant tips constructed in TriplEX2TM phagemid was purchased from Clontech (Cat. # CS1009u, BD Biosciences Clontech, Palo

Alto, USA). Total RNA was isolated from plant tips using the acid-guanidinium-phenol-

chloroform method (Sambrook et al., 1989) and 5g of poly(A)+ RNA was purified using Oligotex mRNA isolation kit (Qiagen USA, Valencia, CA). A library of 3.6x106 independent

clones was obtained with an average insert size of 1.5 kb and an insert size range between 0.5-

3.8 kb.

Library screening

The amplified cDNA expression library was subjected to immuno and PCR screenings as

described in the protocol suggested by the manufacturer (BD Biosciences Clontech, Palo

Alto, CA).

Polyclonal antiserum from chicken and mice was raised against isolated Forisomes (II.2.1).

Absorption of non-specific antibodies that react with E. coli proteins was carried out using a

lysate of E. coli XL-1Blue as described in the protocols provided with the picoBlue

immunoscreening kit (Stratagene). These pre-absorbed sera (dil. 1:30000) were used for

immunoscreening of the cDNA Expression Library using species-specific, horseradish

peroxidase-conjugated goat anti-mouse IgG (H+L, Fc) or rabbit anti-chicken (Fc) (Dianova)

antibodies as secondary antibody.

PCR screening of the amplified cDNA expression library was carried out using a mixture of

primers designed according to the Forisome sequenced peptides (II.2.2).

II.2.5.2 cDNA libraries

Construction of subtracted cDNA library

PCR-select cDNA subtraction was employed using PCR-SelectTM cDNA Subtraction Kit (BD

Biosciences Clontech, Palo Alto, CA) according to the manufacturer's protocol. The tester

(samples prepared from Vicia faba plant leaves) and driver (samples from the Vicia faba root

tips) cDNA were reverse transcribed from 2 g mRNA of leaves and root tips, respectively,


23

digested with RsaI and then ligated to different adaptors. Two rounds of hybridization and

PCR amplification were performed to enrich the differentially expressed sequences.

Construction of not subtracted cDNA library

Total RNA was isolated from Vicia faba young root tips by the acid-guanidinium-phenol-

chloroform method (Sambrook et al., 1989) and used for cDNA library construction

following the SMART TM PCR cDNA Synthesis Kit protocol (BD Biosciences Clontech, Palo

Alto, CA).

The subtracted and non subtracted cDNAs were inserted directly into the TOPO TA Cloning

strategy (InvitrogenTM) followed by TOP10F transformation (InvitrogenTM), producing the

resultant cDNA libraries.

Both unamplified libraries were plated onto LB agar 230 mm x 230 mm Vented QTray with

cover plates (Cat. # X6023, Genetix, New Milton, UK) containing LB agar, 50 g/ml

kanamycin, spreaded with 40 l of 100 mM IPTG in addition to 40 l of 40 mg/ml X-gal on

each LB plate) and grown at 37oC overnight. Using a QPix (Genetix, New Milton, UK)

picking/gridding robot a blue/white screening was carried out and the white colonies were

arrayed into 384-well microtiter plates (384 Well Low Profile Microplate, flat bottom with

cover, Cat.#X6001, Genetix, New Milton, UK) containing LB medium supplemented with

freezing mix [0.4 mM Mg SO4, 1.5 mM Na3-citrate, 6.8 mM (NH4)2SO4, 3.6% (v/v) glycerol,

13 mM KH2PO4, 27 mM K2HPO4, pH 7.0]. Bacteria were grown in microtitre plates wells at

37oC overnight and the clones were gridded onto 222 mm x 222 mm Nylon filters membranes

(Hybond-N+, Amersham) in duplicate pattern for DNA hybridizations.

cDNA libraries screening

Hybridization screening was carried out on subtracted and non-subtracted Vicia faba cDNA

libraries using mixtures of isotope labeled ([32P]ATP) oligonucleotides designed according to Forisome sequenced peptides (II.2.2) as probes.

Approximately 30,000 clones from the subtracted cDNA library and 20,000 clones from the

not subtracted cDNA library were transferred using a Biomek 2000 with 384 High Density

Replica Tool (HDRT) (Beckmann Coulter, Fullerton, US) to Hybond-N+ (Amersham)

membranes placed over LB-Kan-X-Gal plates and incubated at 37C overnight. After 30 min

of incubation positioned face up onto Whatman 3MM paper soaked with denaturation buffer

(0.5 M NaOH; 1.5 M NaCl), the membranes were washed with neutralization buffer (1.5

NaCl; 0.5 M Tris-HCl pH 7.2) for another 5 min. Following softly cleaning of the cells debris

with a paper, the membranes were washed with 2XSSC buffer and air dried on Whatman


24

3MM paper. The nylon filters were exposed at 50 mJoule under UV cross linker (GS Gene

Linker UV Chamber, Bio-Rad). Prehybridization was carried out with hybridization buffer

[5X SSC, 10X Denhardt solution, 1% (w/v) SDS and 10 g/ml of denatured salmon sperm DNA (Boehringer, Mannheim)] at 48C for 1 h with gentle shaking in waterbath and the

membranes were hybridized overnight in the same conditions upon addition of the labeled

probes in 300 l of hybridization buffer (90C). After hybridization, membranes were washed by gently shaking twice for 10 min in 2XSSC containing 0.1% (w/v) SDS at RT and another

two times at 48C. Radioactivity on the membranes was detected by placing the membranes

on a support, sealing them with Saran wrap and then exposing to imaging plates for 12 h.

Hybridization signals were detected by a phosphorimager (FLA-3000, FUJI).

100X Denhardt solution: 2% (w/v) Ficoll, 2% (w/v) PVP and 2% (w/v) BSA

II.2.6 PCR technologies

II.2.6.1 Cloning of 5 and 3 ends of full-length cDNAs using RACE-PCR

3- and 5- RACE-Ready cDNA populations were synthesized from mRNA using BD

SMARTTM RACE cDNA amplification kit (BD Biosciences Clontech, Palo Alto, CA).

Primer design and PCR for detection of expression of hypothetical Forisome gene

Gene-specific primers 3-RACE-GSP1 and 5-RACE-GSP1 were designed based on an EST

fragment from Medicago truncatula containing the identified Forisome peptides. These

primers were used for the first round of 3- and 5- RACE-PCR, repectively. The criteria for

primer design was that they should be 23 to 28 nucleotides long (optimum 25 nucleotides)

having 50% to 70% GC content with melting temperature ~ 70C, which enables touchdown

PCR. PCR conditions for detection of the gene expression from 3- and 5- RACE-Ready

cDNA populations were as follows: 5 cycles of 94C for 30 sec, 72C for 3 min, 5 cycles of

94C for 30 sec, 70C for 30 sec, and 72C for 2 min, 20 cycles of 94C for 30 sec, 67C for

30 sec, 72C for 2 min, followed by 72C for 10 min. The performance of each PCR reaction

was checked by running 5 l of each reaction on agarose gels (II.2.7.4), with appropriate DNA markers.

5-RACE. The 5-most Forisome-related sequences were obtained by performing 5RACE

(rapid amplification of cDNA ends) with a SMART RACE cDNA amplification kit (BD

Biosciences). First-strand cDNA was synthesized from poly(A)+ RNA at 42C for 1 h with

PowerScript reverse transcriptase by using 5- RACE CDS primer [T25VN, where N is A, C,

G or T and V is A, G or C]. The SMART II A oligonucleotide (5-AAGCAGTGGTATCAAC


25

GCAGAGTACGCGGG-3) was included. This oligonucleotide anneals to the C-rich cDNA

3 tail and serves as a primer for second strand DNA synthesis. After the first PCR

amplification with 5-RACE-GSP1 primer, different gene-specific backward primers (5-

RACE-GSP), derived from the hypothetical Forisome sequence obtained, were used to

perform four additional rounds of 5-RACE-PCR, along with a universal primer (5-

CTAATA CGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAG T-3) that can

anneal to the SMART II A oligonucleotide sequence.

3 RACE. The 3-most Forisome-related sequences were obtained by performing 3-RACE

with a SMART RACE cDNA amplification kit. First-strand cDNA was synthesized from

poly(A)+ RNA at 42C for 1 h with reverse transcriptase by using the oligo(dT)-based 3-

RACE CDS primer A [AAGCAGTGGTATCAACGCAGAGTAC(T)30VN, where N is A, C,

G, or T and V is A, C, or G]. Different gene-specific forward primers (3RACE-GSP) were

derived from the hypothetical Forisome sequence obtained in the first round of amplification.

These specific primers were used in the subsequent PCRs along with the universal primer that

can anneal to primer A.

After examination by gel electrophoresis (II.2.7.4), RACE reaction products were cloned into

pCR 2.1-TOPO (Invitrogen) (please refer to the appendices VII.2). White colonies were

selected and the verification of inserts was done by colony PCR. PCR conditions were as

follows: 94C for 4 min, 25 cycles of 94C for 30 sec, 53C for 30 sec, 72C for 1 min, and

72C for 10 min. Four to five independent clones for each of the 5- and 3-RACE products

were sequenced from both ends using generic sequencing primers. The assembled cDNA

sequences were aligned with the Forisome genomic sequence using the Wisconsin Package

v10.2, Genetics Computer Group (GCG), Madison, Wisc.

II.2.6.2 PCR amplification of cDNA

Polymerase chain reaction (PCR) was used for amplification of Forisome gene from a Vicia

faba RACE-Ready cDNA population (II.2.6.1). Double-stranded cDNA was amplified, based

on the protocol of Sambrook et al. (1989), using high fidelity DNA-polymerase and DNA

polymerase buffer from Roche. Two specific primers, 5-CATGCCATGGGAATGTCCTTTT

CTAACTCA-3 and 5-TAAAGCGGCCGCAACACCAAAGTTATTTGG-3 corresponding

to amino-terminal and carboxyl-terminal regions respectively (III.3.1), were used in the

amplification to introduce the NcoI and NotI restriction sites. The reactions were performed in

0.2 ml PCR reaction tubes (Biozym Diagnostik GmbH, Hessisch Oldendorf), using a DNA

thermal Cycler (MWG). PCR reactions were carried out in a total volume of 50 l under the following conditions: 95C for 2min, 35 cycles of 95C for 1 min, 53C for 1 min, 72C for 2


26

min 50 sec, and 72C for 5 min. The performance of each PCR reaction was checked by

running 5 l of each reaction on agarose gels (II.2.7.4), with appropriate DNA markers.

II.2.6.3 Identification of introns and genomic DNA cloning by LD PCR

Intron sequences were identified by LD PCR with the Expand Long Template PCR System

(Roche) using 100 ng of genomic DNA as a template; thermocycling was performed at 95C

for 2 min, 95C for 10 sec, 53C for 30 sec and 68C for 5 min, for 10 cycles; 95C for 15

sec, 53C for 30 sec and 68C for 5 min, for 25 cycles followed by 68C for 7 min. The

performance of each PCR reaction was checked by running 5 l of each reaction on agarose gels (II.2.7.4), with appropriate DNA markers. The amplified fragments were cloned into

pCR 2.1-TOPO (Invitrogen) (please refer to the appendices VII.2) and sequenced. Intron

delimitation within genomic sequences was done by comparing with the putative Forisome

cDNA sequence using the Wisconsin Package v10.2, Genetics Computer Group (GCG),

Madison, Wisc.

II.2.6.4 Genome Walking

Genomic DNA was extracted from Vicia faba young leaves as described before and was used

for genome walking experiments. Genome-walking PCR was performed using a Genome

Walker kit (BD Biosciences Clontech Laboratories, Palo Alto, CA) according to the

manufacturers manual. Briefly, Vicia faba genomic DNA was digested by DraI, HpaI and

SspI restriction enzymes. Adaptor DNA provided in the kit was ligated to the blunt-end DraI-,

HpaI- and SspI-digested genomic DNA fragments generating three Genome Walking

Libraries. The first PCR was conducted using an adaptor primer (5-GTAATACGACTCACT

ATAGGGC-3) provided by the kit and a GSP1 (5-CACAATGGGGATCCACAAAATCTT

GAA-3) that was complementary to the 5 region of Forisome cDNA. Second-round PCR

was done using the nested adaptor primer (5-ACTATAGGGCACGCGTGGT-3) and GSP2

(5-TCTGAACCGTTCCTTGCGGATATCGTC-3) complementary to the upstream

sequence of Forisome. The conditions used for the first and second PCR were 7 cycles at

94C for 25 sec and at 72C for 3 min, 32 cycles at 94C for 25 sec and at 67C for 3 min

followed by one cycle at 67C for 7 min, five cycles at 94C for 25 sec and at 72C for 3

min, and 20 cycles at 94C for 25 sec and at 67C for 3 min followed by one cycle at 67C for

7 min, respectively. The DNA amplified by PCR was cloned into pCR 2.1-TOPO

(Invitrogen) and was sequenced.

The performance of each PCR reaction was checked by running 5 l of each reaction on agarose gels (II.2.7.4), with appropriate DNA markers.


27

II.2.7 Recombinant DNA technologies

All procedures for nucleic acid manipulation were done according to standard methods

(Sambrook et al., 1989) unless otherwise described.

II.2.7.1 Isolation of plasmid DNA from E.coli

Recombinant plasmid DNA was purified using QIAgen plasmid DNA Mini-and Midi- prep

kits according to the manufacturers instructions based on the alkaline lysis method

(Sambrook et al., 1989). Quality and yield of plasmid DNA was examined by

spectrophotometric analysis (II.2.7.2) and agarose gel electrophoresis (II.2.7.4). Isolated

plasmid DNA was stored at -20C.

II.2.7.2 Quantification of DNA

The DNA concentration was evaluated by optical density (1 OD260nm unit = 50 g/ml of

double stranded DNA) according to Sambrook and Russell (2000). The DNA purity was

determined by the OD260nm/OD280nm ratio of the measured optical density, which is 1.8 for

pure DNA.

II.2.7.3 PCR amplification

For rapid identification of recombinant E. coli and Agrobacteria control PCR was carried out

to detect plasmids as described by Jesnowski et al. (1995).

The optimal annealing temperature (Tp) of the primers was experimentally optimised or

calculated based on the empiric formula (Wu et al., 1991):

Tp = {22 + 1,46 [2X (G + C) + (A + T)]}

PCR reactions were carried out in a total volume of 50 l as described in table II-5.

Amplification was carried out under the following conditions: initial denaturation at 95C for

2 min, 35 cycles of denaturation at 95C for 1 min, primer annealing at 55C for 1 min,

primer extension at 72C for 1 min, and final extension at 72C for 5 min. The annealing

temperature and the time for denaturation were changed according to Tp value of primers and

the length of the target gene. The performance of each PCR reaction was checked by running

5 l of each reaction on agarose gels (II.2.7.4) with appropriate DNA markers.


28

Table II-5 PCR reactions

Components Volume Final concentration 10X PCR buffer 5 l 1X

50 mM MgCl2 1.5 l 1.5 mM

10 mM dNTPs 1 l 0.2 mM each

10 pmol forward Primer 0.5-1 l 10 pmol

10 pmol backward primer 0.5-1 l 10 pmol

Template DNA 0.5-5 l 10-100 ng

Taq DNA polymerase (5U/l) 0.25 l 1.25 units

dd H2O to 50 l

II.2.7.4 Agarose gel electrophoresis of DNA

Plasmid DNA, and PCR-fragments were separated in 0.8-1.2% (w/v) agarose gels prepared in

TBE buffer containing 0.1 g/ml of ethidium bromide. Agarose gels and electrophoresis of the samples were carried out as described by Sambrook et al., (1989). Known amounts of

DNA molecular markers such as 1 Kb ladder (New England Biolabs), 100 bp ladder (New

England Biolabs) were used for evaluation and determination of DNA concentration and size.

The DNA samples were loaded onto the agarose gels after the addition of DNA loading

buffer. The visualization of the DNA bands and documentation of the gels was performed

using a UV transilluminator at 302 nm and a black and white E.A.S.Y 429K camera (Herolab)

together with a photo printer (Mitsubishi).

TBE buffer (pH 8): 90mM Tris base, 90mM boric acid, 0.2 M EDTA

DNA loading buffer: 1x TBE, 5% (w/v) sucrose, 0.04% (w/v) bromophenol blue, 2% (w/v)

SDS

II.2.7.5 Preparative agarose gel electrophoresis

Preparative gel electrophores

Documents

Cloning and molecular characterization of vff1 gene ...darwin.bth.rwth-aachen.de/opus3/volltexte/2007/2087/pdf/Fontanell... · II.2.5 Libraries construction and screening strategies