c© Indian Academy of Sciences

ONLINE RESOURCES

Polymorphic microsatellite loci in Chinese piebald odorous frog(Odorrana schmackeri)

YU WANG1,2 and PING DING1,2∗

1College of Life Sciences, Zhejiang University, Hangzhou 310058, People’s Republic of China2The Key Laboratory of Conservation Biology for Endangered Wildlife, Ministry of Education, Hangzhou 310058,

People’s Republic of China

[Wang Y. and Ding P. 2011 Polymorphic microsatellite loci in Chinese piebald odorous frog (Odorrana schmackeri). J. Genet. 90, e44–e46.Online only: http://www.ias.ac.in/jgenet/OnlineResources/90/e44.pdf]

Introduction

The Chinese piebald odorous frog (Odorrana schmackeri) iswidely distributed in the southern and south-central areas ofP. R. China (Fei et al. 2005). In recent years, populationsin the wild have declined as their habitats have been alteredfor infrastructure development, dam construction, consump-tion harvesting and fisheries (Lau et al. 2004). Additionally,the skin of O. schmackeri secretes the antimicrobial pep-tide odorranin, which exhibits significant inhibitory activ-ities against Staphylococcus aureus and Escherichia coli(Zhou et al. 2007), making wild frogs susceptible to over-exploitation. Thus, for the conservation and sustainable har-vesting of wild populations of O. schmackeri, it is worth-while to examine the species for artificial breeding. However,captive populations tend to be less genetically diverse thanwild populations (Sunden and Davis 1991). Additionally,given its wide distribution, this species lends itself well to alarge-scale phylogeography study. Finally, with its relativelylow vagility and philopatric breeding sites of the species, itcan be used as a model for analysing the effects of ecologicalprocesses on genetic variables.

Microsatellites are highly variable molecular markers thatare widely used in molecular ecology and conservationgenetics (Knopp and Merilä 2009; Murphy et al. 2010).However, to date, no reported study has used microsatellitesto examine genetic variation in O. schmackeri. Here, we iso-lated eight polymorphic microsatellite loci in O. schmackeri.These can be used to assess the genetic diversity of wild pop-ulations, monitor cultured populations, and reveal the overallgenetic structure and gene flow of O. schmackeri.

∗For correspondence. E-mail: dingping@zju.edu.cn.

Materials and methods

In total, 30 toe samples of Odorrana schmackeri werecollected from Hangzhou, P. R. China. Genomic DNAwas isolated using a standard proteinase K and phenol–chloroform protocol (Sambrook et al. 1989; Wang et al.2009). Microsatellite DNA fragments were enriched usingthe protocol of Shao et al. (2009). Genomic DNA wasdigested with the restriction enzyme Sau3AI (Takara, Dalian,P. R. China), then 300–1000-bp fragments were isolated andpurified using a DNA Gel Extraction kit (Axygen, Hangzhou,P. R. China). Double-stranded Sau3A adapters (Sau3AL:5′-GGC CAG AGA CCC CAA GCT TCG-3′ and Sau3AR:5′-GAT CCG AAG CTT GGG GTC TCT GGC C-3′) wereligated to DNA fragments using the T4 DNA ligase (Takara,Dalian, P. R. China), and the linker-ligated fragments werethen amplified with specific primer Sau3AL by polymerasechain reaction (PCR) to test the ligation efficiency. The frag-ments with adapters were hybridized with biotin-labelleddinucleotide repeat sequences (CA)15 probes. Finally, themicrosatellite-enriched DNA fragments were captured bymagnetic streptavidin beads (Promega, Beijing, P. R. China).

Purified PCR products (microsatellite-enriched DNA frag-ments) were ligated into the pMD19-T vector (Takara,Dalian, P. R. China) and then transformed into E. coli DH5α

competent cells (Takara, Dalian, P. R. China). Transformedcells grew at 37◦C for 16 h on LB/Amp+/IPTG/X-Gal platesfor blue/white selection to identify positive clones. In total,576 positive clones were amplified with the primer Sau3ALand oligonucleotides (CA)15, then sequenced using the 3730Bigdye-Terminator (ABI, Foster City, USA). Primers weredesigned using Primer 5 (Lalitha 2000).

In total, 45 primer pairs were tested for amplification, eightof which amplified a consistent product. All samples wereused to test for polymorphisms. Reaction volume, 10-μL,

Keywords. Chinese piebald odorous frog; SSR; genetic diversity; heterozygosity; polymorphic.

Journal of Genetics Vol. 90, Online Resources e44

Polymorphic microsatellite loci in Odorrana schmackeri

Table 1. Characterization of eight polymorphic microsatellite loci isolated from Odorrana schmackeri.

GenBankLocus Repeat motif Primer sequence (5′–3′) Size range (bp) Ta (◦C) NA HO HE PIC accession number

Osch01 (CA)13(CT)8 L: TTCACAAGCACCGCAACA 273–291 60 9 0.737 0.791 0.752 HM120864R: AGAGCGAAGGAGTTAAGAAGT

Osch02 (AC)57 L: CCCATTCAGATATGTAAC 214–248 47 7 0.553 0.692 0.642 HM120865R: AAAATATGCACTGTCACT

Osch03 (CA)10 L: CCTGTGCTCCCCAAAGAA 100–156 55 10 0.079 0.637 0.613∗ HM120866R: CCAGCCCTGTGATACCGA

Osch04 (GT)19 L: TGTAAACCAAGACCCTCG 104–162 51 13 0.105 0.821 0.795∗ HM120867R: TAGCTGAACAGTAAAATCATCA

Osch05 (CT)10 L: ATCCAAGCTGCACTCAG 191–232 55 10 0.694 0.667 0.598 HM120868R: TGTCTCCATAGCCTCATT

Osch06 (AC)6(TC)8 L: TTCACAAGCACCGCAACA 275–297 55 8 0.656 0.794 0.751 HM120869R: AGAGCGAAGGAGTTAAGAAGT

Osch07 (CT)15 L: TATTCAGCCCTAATTCACA 170–230 53 14 0.838 0.759 0.735 HM120870R: GTCTTCATAGCCTCGTTCT

Osch08 (CT)3CCA(CT)8 L: CCCATTTCAGTTGAGTGC 174–248 48 5 0.464 0.651 0.578 HM120871R: CTGCTGCCTTCAGTAAAG

NA, number of alleles; HO and HE, observed and expected heterozygosity; Ta, optimal annealing temperature; PIC, polymorphisminformation content. *Significant deviation from Hardy–Weinberg equilibrium (P < 0.01).

of the PCR amplification consisted of 0.12 μM of eachprimer (5′-modified with FAM or HEX), 0.75 U Taq DNApolymerase, 0.15 mM of each dNTP, 10 mM Tris-HCl,50 mM KCl, 1.5, 2, or 2.5 mM MgCl2 and 50 ng DNA. PCRreactions were conducted as follows: 5 min at 95◦C, followedby 35 cycles of 30 s at 95◦C, 30 s at the annealing temper-ature listed in table 1, and 35 s at 72◦C, with a final 7 minextension at 72◦C. The PCR products were genotyped usinga MegaBACE 1000 DNA sequencer (Pharmacia, Stockholm,Sweden), and analysed using the Genetic Profiler software(supplied with the sequences).

The characteristics of eight loci were estimated in terms ofalleles per locus, size range, observed and expected heterozy-gosities (HO and HE) and polymorphism information con-tent (PIC) using the CERVUS software version 2.0 (Marshallet al. 1998). Deviations from Hardy–Weinberg equilibrium(HWE) for each locus and linkage disequilibrium between allpairs of loci were tested using the GENEPOP 4.0 software(Rousset 2008). Microchecker (Van Oosterhout et al. 2004)was used to detect null alleles.

Results and discussion

The allelic number per locus varied from 5 to 14 (average,9.5). Observed and expected heterozygosities ranged from0.079 to 0.838 (average, 0.516) and from 0.637 to 0.821(average 0.727), respectively. The mean PIC value was 0.683(range, 0.578–0.795). Loci Osch03 and Osch04 showed sig-nificant deviation from HWE (P < 0.01), and null allele exis-tence was detected by Microchecker. Linkage disequilibriumwas tested among all loci pairwise, and the results showedsignificant linkage between loci Osch01 and Osch06 and lociOsch03 and Osch06, but there was no evidence that Osch01and Osch03 exhibited significant deviation from linkage

disequilibrium. These polymorphic microsatellite markerscould be useful for examining population structure as wellas developing management and conservation initiatives forO. schmackeri.

Acknowledgements

We thank Pingping Jiang for English improvement in themanuscript. This research was supported by National Natural Sci-ence Foundation of P. R. China (no. 30870315).

References

Fei L., Ye C. Y. and Huang Y. Z. 2005 An illustrated key toChinese amphibians (ed. Sichuan). Publishing House of Scienceand Technology Press, Chengdu, P. R. China.

Knopp T. and Merilä J. 2009 Microsatellite variation and populationstructure of the moor frog (Rana arvalis) in Scandinavia. Mol.Ecol. 18, 2996–3005.

Lalitha S. 2000 Primer Premier 5. Biotech Software Internet Rep. 1,270–272.

Lau M. W. N., Geng B. R., Gu H. Q., Yuan Z. G. and Lue K. Y.2004 Odorrana schmackeri. In IUCN 2010. IUCN red list ofthreatened species. Version 2010.1. http://www.iucnredlist.org.

Marshall T. C., Slate J., Kruuk L. E. B. and Pemberton J. M. 1998Statistical confidence for likelihood-based paternity inference innatural populations. Mol. Ecol. 7, 639–655.

Murphy M. A., Dezzani R., Pilliod D. S. and Storfer A. 2010 Land-scape genetics of high mountain frog metapopulations. Mol. Ecol.19, 3634–3649.

Rousset F. 2008 Genepop’007: a complete re-implementation of thegenepop software for Windows and Linux. Mol. Ecol. Notes 8,103–106.

Sambrook J., Fritsch E. F. and Maniatis T. 1989 Molecular cloning:a laboratory manual, 2nd edition. Cold Spring Harbor Labora-tory Press, New York, USA.

Shao C., Wang Y. and Qiao N. N. 2009 Isolation and charac-terization of microsatellite loci in tiger frog (Hoplobatrachusrugulosus). Conserv. Genet. 10, 1601–1603.

Journal of Genetics Vol. 90, Online Resources e45

Yu Wang and Ping Ding

Sunden S. L. F. and Davis S. K. 1991 Evaluation of genetic vari-ation in a domestic population of Penaeus vannamei Boone:a comparison with three natural populations. Aquaculture 97,131–142.

Van Oosterhout C., Hutchinson W. F., Wills D. P. M. and ShipleyP. 2004 Micro-checker: software for identifying and correctinggenotyping errors in microsatellite data. Mol. Ecol. Notes 4, 535–538.

Wang Y., Qiao N. N., Shao C. and Xu Z. Z. 2009 Applica-tion of nondestructive sampling using in Anuran conservationgenetics. J. Zhejiang Normal University (Nat. Sci.) 32, 322–325(in Chinese with English abstract).

Zhou J. W., Li L., Ke L. J., Gao G. Z. and Rao P. F. 2007 Isolation,purification and characterization of Odorranin from skin secre-tion of Odorrana schmackeri. Chin. J. Veterinary Drug 41, 20–23(in Chinese with English abstract).

Received 25 September 2010; in final revised form 17 December 2010; accepted 29 December 2010Published on the Web: 18 August 2011

Journal of Genetics Vol. 90, Online Resources e46