Equine Herpesvirus 1 Multiply Inserted Transmembrane ProteinpUL43 Cooperates with pUL56 in Downregulation of Cell SurfaceMajor Histocompatibility Complex Class I

Teng Huang, Guanggang Ma, Nikolaus Osterrieder

Institut für Virologie, Zentrum für Infektionsmedizin-Robert von Ostertag-Haus, Freie Universität Berlin, Berlin, Germany

ABSTRACT

Herpesviruses have evolved an array of strategies to counteract antigen presentation by major histocompatibility complexclass I (MHC-I). Previously, we identified pUL56 of equine herpesvirus 1 (EHV-1) as one major determinant of the down-regulation of cell surface MHC-I (G. Ma, S. Feineis, N. Osterrieder, and G. R. Van de Walle, J. Virol. 86:3554 –3563, 2012,http://dx.doi.org/10.1128/JVI.06994-11; T. Huang, M. J. Lehmann, A. Said, G. Ma, and N. Osterrieder, J. Virol. 88:12802–12815, 2014, http://dx.doi.org/10.1128/JVI.02079-14). Since pUL56 was able to exert its function only in the context of vi-rus infection, we hypothesized that pUL56 cooperates with another viral protein. Here, we generated and screened a seriesof EHV-1 single-gene deletion mutants and found that the pUL43 orthologue was required for downregulation of cell sur-face MHC-I expression at the same time of infection as when pUL56 exerts its function. We demonstrate that the absenceof pUL43 was not deleterious to virus growth and that expression of pUL43 was detectable from 2 h postinfection (p.i.) butdecreased after 8 h p.i. due to lysosomal degradation. pUL43 localized within Golgi vesicles and required a unique hydro-philic N-terminal domain to function properly. Finally, coexpression of pUL43 and pUL56 in transfected cells reduced thecell surface expression of MHC-I. This process was dependent on PPxY motifs present in pUL56, suggesting that late do-mains are required for pUL43- and pUL56-dependent sorting of MHC class I for lysosomal degradation.

IMPORTANCE

We describe here that the poorly characterized herpesviral protein pUL43 is involved in downregulation of cell surface MHC-I.pUL43 is an early protein and degraded in lysosomes. pUL43 resides in the Golgi vesicles and needs an intact N terminus to in-duce MHC-I downregulation in infected cells. Importantly, pUL43 and pUL56 cooperate to reduce MHC-I expression on thesurface of transfected cells. Our results suggest a model for MHC-I downregulation in which late domains in pUL56 are requiredfor the rerouting of vesicles containing MHC-I, pUL56, and pUL43 to the lysosomal compartment.

The interplay between viruses and their hosts has led to theevolution of a number of strategies that facilitate evasion from

the recognition and clearance of virus infection by the host im-mune system. Upon successful entry into the cell, viruses are un-coated. Structural components of the invading virus as well asnewly produced proteins are polyubiquitinated and then frag-mented into peptides by the proteasome (1). The processed anti-genic peptides are transported into the endoplasmic reticulum(ER) and presented by major histocompatibility complex class I(MHC-I) molecules on the cell surface. Cytotoxic CD8� T lym-phocytes (CTL), whose T-cell receptor (TCR) specifically recog-nizes small peptides bound in the groove of MHC-I, ultimatelyeliminate the infected cell (2, 3). However, CTL-mediated immu-nity may fail or be delayed, because many viruses encode specificinhibitors that interfere with various stages of MHC-I antigenpresentation (4). As a consequence, infected cells have reducedMHC-I expression and become less sensitive to patrolling CTL.

Equine herpesvirus 1 (EHV-1) is an important veterinary patho-gen that poses a severe risk to the health of horse populations aroundthe world. EHV-1 infection results in various clinical syndromes in-volving upper respiratory ailments, miscarriage, death of neonates,and neurological disease (5). Classified as a member of the Alphaher-pesvirinae subfamily, EHV-1 is a double-stranded DNA virus fea-turing a large genome of �150 kbp. The EHV-1 genome containsat least 80 open reading frames (ORFs), of which at least 4 ORFs

are duplicated in the inverted-repeat regions (6). Historically, theEHV-1 genome has been annotated in accordance with those ofherpes simplex virus 1 (HSV-1) and varicella-zoster virus (VZV),prototype viruses of the Alphaherpesvirinae. This approach hasalso been applied to other closely related viruses, e.g., EHV-4 andpseudorabies virus (PRV) (7, 8). Hence, the role of a particularEHV-1 gene product can be deduced on the basis of its HSV-1 orVZV counterpart and extended to predict the function of the or-thologues that are conserved in the genus, subfamily, or even fam-ily. Nevertheless, several genes and/or gene functions are uniqueto HSV-1, VZV, or EHV-1. For instance, HSV-1 ICP47 was thefirst protein identified in the Alphaherpesvirinae to induce down-

Received 6 January 2015 Accepted 27 March 2015

Accepted manuscript posted online 1 April 2015

Citation Huang T, Ma G, Osterrieder N. 2015. Equine herpesvirus 1 multiplyinserted transmembrane protein pUL43 cooperates with pUL56 indownregulation of cell surface major histocompatibility complex class I. J Virol89:6251–6263. doi:10.1128/JVI.00032-15.

Editor: R. M. Longnecker

Address correspondence to Nikolaus Osterrieder, no.34@fu-berlin.de.

Copyright © 2015, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JVI.00032-15

The authors have paid a fee to allow immediate free access to this article.

June 2015 Volume 89 Number 12 jvi.asm.org 6251Journal of Virology

on May 19, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

regulation of MHC-I at the cell surface by directly interactingwith the transporter associated with antigen processing (TAP).ICP47 irreversibly prevents the transport of cytoplasmic pep-tides into the ER (9), but ICP47 homologues are absent inEHV-1 and other varicelloviruses, including VZV. EHV-1 alsocauses MHC-I downregulation in a species-independent fash-ion, and the pUL49.5 and pUL56 proteins have been shown tomodulate cell surface MHC-I expression (10, 11); however,pUL49.5 and pUL56 of HSV-1 do not affect MHC-I levels (12).

The pUL56 and pUL49.5 homologues of various members ofthe Alphaherpesvirinae differ in their expression patterns and sub-cellular localizations (11, 13), indicating that they are mechanis-tically different. EHV-1 pUL49.5, a small type I transmembraneprotein that interacts with viral glycoprotein M (gM) (14), inhib-its the formation of peptide-loaded MHC-I molecules by prevent-ing ATP binding to TAP (10). pUL56, a type II transmembraneprotein, enhances the internalization of MHC-I through dy-namin-dependent endocytosis (15). In our previous studies, wereported that pUL56 induced cell surface MHC-I reduction solelyin the context of infection and that MHC-I levels were not com-pletely restored when cells were infected with a mutant virus lack-ing both pUL49.5 and pUL56 (11). These findings gave rise to thehypothesis that another viral protein partners with pUL56 andparticipates in the downregulation of cell surface MHC-I.

The efforts of our work presented here focused on the identi-fication of viral gene products that contribute to the downregula-tion of MHC-I in cells after EHV-1 infection. By screening a sin-gle-gene knockout library of EHV-1, the product of the HSV-1UL43 homologue was identified to potently block surface MHC-Ipresentation in EHV-1-infected cells. Further characterizationshowed that pUL43 is nonessential for virus growth in vitro and isdegraded in lysosomes at later times of infection. pUL43 also lo-calizes to Golgi vesicles and requires its four C-terminal trans-membrane (TM) domains for proper intracellular distribution.We also found that a unique hydrophilic domain of EHV-1 pUL43is indispensable for reducing MHC-I levels. Finally, cotransfec-tion of pUL43 and pUL56 resulted in robust inhibition of cellsurface MHC-I expression. Taken together, these results suggest anovel mechanism by which alphaherpesviruses utilize a combina-tion of viral transmembrane proteins to negatively regulateMHC-I antigen presentation and achieve immune evasion.

MATERIALS AND METHODSCells and viruses. Equine dermal (NBL6) cells were propagated in Eagle’sminimum essential medium (EMEM; Biochrom AG) supplemented with20% fetal calf serum (FCS; Biochrom AG), 1% penicillin-streptomycin(100 U/ml penicillin and 100 �g/ml streptomycin; Sigma-Aldrich), 1 mMsodium pyruvate, and 1� nonessential amino acids (Biochrom AG).RK13 (rabbit kidney) cells, HeLa (human epithelial carcinoma) cells, andHEK293 (human embryonic kidney) cells were grown in EMEM contain-ing 5% FCS and 1% penicillin-streptomycin. RK13 cells that constitu-tively express either the ER marker calreticulin or the Golgi marker �-1,4-galactosyltransferase fused to enhanced green fluorescent protein (EGFP)were generated by transfection of the plasmids pER-EGFP and pGolgi-EGFP, respectively, which were kindly provided by Michael Veit (FreieUniversität Berlin, Berlin, Germany). The transfected cell lines were pu-rified and maintained in the medium for RK13 cells supplemented with500 �g/ml G418 disulfate salt (Sigma-Aldrich). The parental and mutantviruses were derived from EHV-1 strain Ab4, which was cloned as aninfectious bacterial artificial chromosome (BAC). The BAC for Ab4 virus(pAb4) contains a mini-F cassette in which the egfp gene is driven by the

human cytomegalovirus (HCMV) immediate early (IE) promoter (16).Viruses were reconstituted by transfection of BAC DNA into RK13 cellswith polyethylenimine (PEI) (Polysciences), as previously described (11).To delete the egfp gene from the viral genome, RK13 cells expressing Crewere infected with the engineered virus at a multiplicity of infection(MOI) of 0.0001 (17). Nonfluorescent viral plaques were picked for puri-fication on RK13 cells. Unless otherwise indicated, RK13 cells were usedfor virus propagation and titration.

Antibodies and reagents. Rabbit anti-�-actin (13E5) monoclonalantibody (MAb) and rabbit and mouse anti-hemagglutinin (HA) tagMAbs were purchased from Cell Signaling Technologies. Rabbit poly-clonal antibodies (PAbs) against EHV-1 pUL56 were prepared as de-scribed previously (11). Rabbit anti-EHV-1 IR6 PAb and anti-EHV-1 gM(F6) and anti-EHV-1 gC (2A2) MAbs were used as described in our pre-vious studies (18–20). Mouse anti-MHC-I MAb specific for an equinehaplotype (CZ3) was kindly provided by Douglas F. Antczak (CornellUniversity, Ithaca, NY). Mouse anti-HLA class I (W6/32) MAb was a giftfrom Hartmut Hengel (Universität Freiburg, Freiburg, Germany). Mouseanti-CD58 MAb was obtained from BioLegend. The mouse IgG isotypecontrol was obtained from Santa Cruz Biotechnology. Alexa Fluor 647- or568-labeled goat anti-mouse immunoglobulin G (IgG) and Alexa Fluor488-labeled goat anti-rabbit and goat anti-mouse IgGs were produced byInvitrogen. Horseradish peroxidase (HRP)-conjugated goat anti-mouseand goat anti-rabbit IgGs were obtained from Southern Biotech. Phos-phonoacetic acid (PAA), an inhibitor of viral DNA synthesis, was ob-tained from Alfa Aesar. Chloroquine and lactacystin were purchased fromSigma-Aldrich. Restriction enzymes were supplied by New England Bio-Labs.

Engineering of BAC mutants. The pAb4 BAC was maintained inEscherichia coli GS1783 cells that were grown in Luria-Bertani (LB) brothin the presence of 30 �g/ml chloramphenicol (11). Genetic modificationof the BAC was performed by en passant mutagenesis exactly as describedpreviously (21). To start mutagenesis, a fragment flanked by homologousarms for the target region was PCR amplified by using a kanamycin resis-tance (Kanr) gene present in plasmid pEP-Kan-S2, using the primerslisted in Table 1. After gel electrophoresis, PCR products were purifiedand subjected to DpnI digestion to eliminate residual plasmid. GS1783competent cells were electroporated with the PCR products and incu-bated at 32°C for 48 h. Kanamycin-resistant colonies were screened byrestriction fragment length polymorphism (RFLP) analysis and comparedto the predicted digestion pattern. Correct intermediates were used for asecond round of Red-mediated recombination in the presence of 1%L-(�)-arabinose (Alfa Aesar) that induced the removal of the Kanr genesequence from the BAC construct. Following the resolution step, candi-date colonies were examined by RFLP analysis and confirmed by DNAsequencing (LGC Sequencing Service). BAC DNA from picked colonieswas prepared by standard alkaline lysis (22) and used for virus reconsti-tution.

Construction of expression vectors. Full-length UL43 or a truncatedform was amplified by PCR using appropriate primers (Table 1). Forcloning, PCR products were digested with EcoRI and BamHI and insertedinto plasmid pEGFP-N3 (Clontech) to obtain fusion proteins with anEGFP tag at the C terminus and were termed pUL43-EGFP (wild type)and pUL43s-EGFP (truncated mutant), respectively. In addition, a con-struct that allows coexpression of pUL43 and pUL56 was generated. First,a transfer vector containing pUL56 and EGFP was created based onpcDNA3 (Invitrogen), with the two genes connected by a P2A linker.Using the linker, pUL56 and EGFP should be expressed with similar stoi-chiometry due to the cotranslational “ribosome skipping” event mediatedby the P2A peptide. This property and the P2A sequence used for thisstudy were reported previously (23). Specifically, PCR products were am-plified by using a forward primer containing the P2A sequence and areverse primer for the egfp gene (Table 1). After digestion with EcoRI andXbaI, the purified P2A-EGFP fragment was ligated into the correspondingsites of a pcDNA3 plasmid harboring the UL56 plasmid, which resulted in

Huang et al.

6252 jvi.asm.org June 2015 Volume 89 Number 12Journal of Virology

on May 19, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

the transfer vector pcUL56-P2A-EGFP. Second, the UL56-P2A-EGFPfragment was released from the transfer plasmid by cutting with BamHIand XbaI. The chimeric sequence was then inserted into the first cloningsite of pVITRO2-mcs-Hygro (InvivoGen), where pUL43 was placed in thesecond cloning site. Similarly, a coexpression vector for pUL43 andpUL56(AY) was constructed, in which all the PPxY motifs in pUL56 hadbeen mutated to AAxY.

Virus growth properties and plaque morphology. The role of theUL43 gene in the production of progeny virus was evaluated by one-stepgrowth kinetics. Confluent NBL6 cells were infected with the parentalvirus vAb4G (16), the mutant virus vUL43STOP, or its revertant virusvUL43STOP_R at an MOI of 3. Cells were incubated at 4°C for 1 h to allowattachment of the viruses and then shifted to 37°C for virus entry. After 1.5h of penetration, infected cells were treated with ice-cold citrate buffer(0.062 M Na2HPO4, 0.132 M citric acid, 0.5% bovine serum albumin[BSA] [pH 3.0]) for 30 s to remove surface-bound virions that had notentered the cells. After washing with phosphate-buffered saline (PBS)three times, fresh medium was added, and the cells were kept at 37°C. Todetermine the extracellular and intracellular virus titers, supernatants andinfected-cell pellets were separately harvested at 0, 4, 8, 12, 24, and 36 hpostinfection (p.i.). Samples were titrated on RK13 monolayers and over-laid with 1.5% (wt/vol) methylcellulose in EMEM. At 72 h p.i., when viralplaques were clearly visible, the methylcellulose was discarded, and the

cells were fixed with 3.5% paraformaldehyde (PFA) in PBS for 5 min.Plaques were counted after staining with a 0.1% (wt/vol) crystal violetsolution. The data are presented as PFU per milliliter from three indepen-dent experiments.

The influence of UL43 on viral cell-to-cell spread was investigated bymeasuring plaque sizes. To this end, each virus at an MOI of 0.0001 wasinoculated onto 6-well plates where RK13 cells were seeded and grown toconfluence. After incubation for 2 h at 37°C, residual virus was removed,and cell monolayers were covered with 1.5% (wt/vol) methylcellulose inEMEM. At 72 h p.i., viral plaques were inspected under a Zeiss AxiovertS100 microscope. For each virus, at least 50 plaques were randomly ac-quired with a digital camera. Diameters of the plaques were measured byusing the ImageJ program (http://imagej.nih.gov/ij/), using a line tool.The measurements were normalized to those from the parental virus,which were set as 100%. Three independent assays were conducted.

Immunofluorescence and microscopy. Cells were seeded onto cov-erslips and grown to 70 to 80% confluence. After transfection or infection,cells were fixed in 3.5% PFA in PBS for 5 min and permeabilized with0.1% Triton X-100 lysis buffer for 10 min. Coverslips were blocked in PBSsupplemented with 3% BSA for 2 h at room temperature (RT). Later, cellsamples were probed with primary antibodies, including anti-HA MAb(1/200), anti-EHV-1 gC MAb (1/100), and anti-pUL56 PAbs (1/200), for1 h. After three washes with PBS, cells were reacted with Alexa Fluor

TABLE 1 List of primers for viral mutagenesis, plasmid construction, and DNA sequencing

Primer Sequence (5=–3=)BAC muatagenesis

43STOP_Fwa CAAAGGTTGGCTTGCTACATCAAGGTTATCAATCATGATGTAACAGCCAGATAGAGAGCCCGGTAGGGATAACAGGGTAATCGAT

43STOP_Rv GCACCAGACACGAGTCTTCACCGGGCTCTCTATCTGGCTGTTACATCATGATTGATAACCTTGCCAGTGTTACAACCAATTAACC

43Rev_Fwb CAAAGGTTGGCTTGCTACATCAAGGTTATCAATCATGATGTACCAGCCAGATAGAGAGCCCGGTAGGGATAACAGGGTAATCGAT

43Rev_Rv GCACCAGACACGAGTCTTCACCGGGCTCTCTATCTGGCTGGTACATCATGATTGATAACCTTGCCAGTGTTACAACCAATTAACC

HA43_Fwc CAAAGGTTGGCTTGCTACATCAAGGTTATCAATCATGATGTACCCATACGACGTCCCAGACTACGCTTACCAGCCAGATAGAGAGCCCCAGTGTTACAACCAATTAACC

HA43_Rv CCAGACACGAGTCTTCACCGGGCTCTCTATCTGGCTGGTAAGCGTAGTCTGGGACGTCGTATGGGTACATCATGATTGATAACCTTGTAGGGATAACAGGGTAATCGATT

HA_oN_43_Fw ATCAATCATGATGTACCCATACGACGTCCCAGACTACGCTAAAGCTTTCGTTGGAATCGGTAGGGATAACAGGGTAATCGATT

HA_oN_43_Rv TGAGGACGCAAGCTTGTAGTCCGATTCCAACGAAAGCTTTAGCGTAGTCTGGGACGTCGTCCAGTGTTACAACCAATTAACC

Expression vectorspUL43s-EGFP

pUL43-EGFP_Fwc GCGAATTCACCATGATGTACCCATACGACGTCCCAGACTACGCTTACCAGCCAGATAGAGAGCCpUL43-EGFP_Rv CGGGATCCATGTGTGATTATAGTTGCATAACACpUL43s-EGFP_Rv CGGGATCCCGGCATCTCCTTGAAAAACTTGAAC

pUL43-UL56-P2A-EGFPpHA43_Fwc CGGGATCCACCATGATGTACCCATACGACGTCCCAGACTACGCTTACCAGCCAGATAGAGAGCCpHA43_Rv GCGAATTCTTTAATGTGTGATTATAGTTGCATAACP2A-EGFP_Fwd CGGAATTCGGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAG

AACCCTGGACCTATGGTGAGCAAGGGCGAGGAGCP2A-EGFP_Rv CGTCTAGATTACTTGTACAGCTCGTCCATG

SequencingUL43_Seq_Fw1 CACTTGTAGAAACACGCCCAUL43_Seq_Fw2 CGTCATATGCTCAGCCAATGUL43_Seq_Rv AACATACCATGCACCAAAGG

a Letters in boldface italic type indicate the stop codon introduced into the UL43 gene.b Letters in boldface italic type indicate the original codon of the UL43 gene.c Underlined nucleotides are the sequence for a hemagglutinin epitope.d Underlined letters represent the P2A sequence with a GSG linker (italic).

Downregulation of Cell Surface MHC-I by pUL43

June 2015 Volume 89 Number 12 jvi.asm.org 6253Journal of Virology

on May 19, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

568-conjugated goat anti-mouse IgG (1/500) or Alexa Fluor 488-conju-gated goat anti-rabbit IgG (1/500) for another hour at RT. After washing,coverslips were mounted onto glass slides, stained with 4=,6-diamidino-2-phenylindole (DAPI) medium (Vector Laboratories), and examinedunder a Zeiss Axio Imager M1 microscope or a confocal laser scanningmicroscope (LSM510; Zeiss).

Western blotting. Cell lysates were extracted with radioimmunopre-cipitation assay (RIPA) buffer (25 mM Tris [pH 7.5], 150 mM NaCl, 1%Nonidet P-40, 0.25% sodium deoxycholate, 0.1% sodium dodecyl sulfate[SDS], 1 mM EDTA) containing a protease inhibitor cocktail (Roche) andBenzonase (Novagen). Samples were separated by SDS-12% polyacryl-amide gel electrophoresis (PAGE), as described previously (15). Afterfractionation, proteins were transferred onto polyvinylidene difluoride(PVDF) membranes (Carl Roth). To prevent unspecific binding, mem-branes were blocked in PBS containing 0.05% Tween 20 (PBST) with 5%(wt/vol) skim milk powder overnight at 4°C. Membranes were thenprobed with the following primary antibodies for 1 h at RT: anti-HA MAb(1/1,000), anti-pUL56 PAb (1/500), anti-EHV-1 IR6 PAb (1/500), anti-EHV-1 gM MAb (1/500), and anti-�-actin MAb (1/1,000). Membraneswere washed with PBST three times and incubated with suitable HRP-conjugated secondary antibodies (1/10,000) for 1 h at RT. After threewashing steps with PBST, reactive proteins on membranes were visualizedby using an enhanced chemiluminescence (ECL) detection kit (Amer-sham ECL Prime; GE Healthcare).

Flow cytometry. Mock-infected, infected, or transfected cells weretrypsinized and suspended in PBS with 2% FCS. To determine cell surfaceMHC-I levels, NBL6 cells were incubated with anti-MHC-I (CZ3) MAb(1/50) or isotype control IgG (1/100); alternatively, HeLa or HEK293 cellswere incubated with mouse anti-HLA class I (W6/32) MAb (1/50). After30 min of incubation on ice, cells were washed with PBS plus 2% FCS threetimes and reacted with Alexa Fluor 647-conjugated goat anti-mouse IgG(1/1,000) for 30 min. At least 10,000 live cells from each sample wereanalyzed by using a FACSCalibur flow cytometry system according to themanufacturer’s instructions (BD Biosciences). The data from flow cytom-etry experiments are presented as mean fluorescence intensity values.

RESULTSIdentification of EHV-1 pUL43 as a novel inhibitor of MHC-Ipresentation. Our previous studies showed that pUL56 failed toreduce cell surface expression of MHC-I molecules in the absenceof virus infection (11), suggesting that there is at least one addi-tional viral gene product that directly or indirectly cooperates withpUL56 to mediate MHC-I downregulation. To identify viral pro-teins functionally cooperating with pUL56, we engineered a li-brary of 26 single-gene knockout mutants of EHV-1 strain Ab4.The library was based on predictions of gene functions, and weparticularly focused on early genes predicted to be nonessentialfor virus growth. Our selection list was shortened only for thosegenes that are functionally unclear or expressed with early kineticsand possibly located in the Golgi vesicles. The mutants were gen-erated by the insertion of a positive selection marker (Kanr) andremoval of the respective open reading frames (ORFs) using enpassant mutagenesis. The reconstituted viruses were tested fortheir potential to downregulate expression levels of cell surfaceMHC-I in equine NBL6 cells (Table 2). Among the generatedmutant viruses, only the ORF17-negative virus was unable to sig-nificantly induce downmodulation of cell surface MHC-I levels.The ORF17 gene product is homologous to HSV-1 pUL43, asestablished by sequence and structure comparisons (6). Given thatthe selection marker may interfere with the expression of neigh-boring ORFs, we minimized the alterations in the viral genomeand abolished expression of pUL43 by replacing the third codonof the ORF (TAC) with a stop codon (TAA) (Fig. 1A and B). Prior

to virus reconstitution, the pAb4 mutant BAC (pUL43STOP) wasconfirmed by RFLP analysis (Fig. 1E) and DNA sequencing (datanot shown). Transfection of pUL43STOP DNA resulted in vi-able virus, and the mutant was termed vUL43STOP. In com-parison to the parental virus, the ability of vUL43STOP to in-duce MHC-I downregulation was substantially attenuated(P � 0.05), consistent with the results of the library screening(Fig. 2A and B). When the stop codon introduced at position 3of the ORF was repaired to the original codon TAC, the result-ing virus mutant, vUL43STOP_R, was able to trigger a reduc-tion of MHC-I with kinetics and efficiency indistinguishablefrom those of the parental virus (P � 0.05) (Fig. 2B). This effectwas mediated exclusively by the UL43 gene, as we confirmedthat the expression of the downstream UL44 (gC) gene was notaffected by the stop codon (data not shown). Our results dem-onstrated that pUL43 plays an important role in regulating cellsurface expression of MHC-I during virus infection. Further-more, we found that pUL43 not only exerted this function inequine cells but also induced a considerable decrease of cellsurface MHC-I expression in human cells (Fig. 2C), indicatingthat pUL43 might govern a conserved pathway in mammaliancells to redistribute MHC-I.

To facilitate detection of pUL43 in further experiments anddue to the lack of a specific antibody, we constructed a mutantvirus, named vHA-UL43, in which the N terminus of pUL43 wastagged with an HA epitope (YPYDVPDYA) (Fig. 1C). With the

TABLE 2 Deletion mutants tested for MHC-I downregulation

Deletionmutant Homologue of HSV-1, function

Virusgrowtha

MHC-Irecoveryb

ORF3 NA, unknown � NORF4 UL55, unknown � NORF5 UL54, transcriptional activator � NORF8 UL51, unknown � NORF11 VP22, tegument protein NAORF12 UL48, tegument protein � NORF13 UL47, tegument protein NAORF14 UL46, unknown � NORF15 UL45, virion protein � NORF17 UL43, multiply hydrophobic protein � YORF19 UL41, host shutoff virion protein � NORF23 UL37, unknown NAORF34 NA, ubiquitinated virion protein � NORF38 UL23, Thymidine kinase � NORF40 UL21, unknown NAORF41 UL20, multiply hydrophobic protein NAORF46 UL16, unknown NAORF48 UL14, unknown NAORF51 UL11, myristoylated virion protein NORF55 UL7, unknown NAORF58 UL4, unknown � NORF59 NA, cytosolic virion protein NAORF63 ICP0, transcriptional activator � NORF68 US2, unknown � NORF67 NA, nucleocapsid egress � NORF76 US9, tegument protein � Na � means that the deletion mutant could be reconstituted and grew efficiently, while indicates that the deletion mutant could not be rescued.b At 6 h p.i., levels of cell surface MHC-I expression in equine NBL6 cells weremeasured and compared between the individual mutant and parental viruses; Y,responsible for MHC-I downregulation; N, not responsible for MHC-I downregulation;NA, not assessed.

Huang et al.

6254 jvi.asm.org June 2015 Volume 89 Number 12Journal of Virology

on May 19, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

inclusion of the HA sequence, the mutant virus was still able toinduce a reduction of cell surface expression of MHC-I and did soas efficiently as the parental virus (P � 0.05) (Fig. 2D).

Abrogation of pUL43 does not impair virus production butslightly affects cell-to-cell spread. It was unknown whetherpUL43 is required for EHV-1 replication in horse fibroblasts. Wetherefore performed one-step growth assays with the parental vi-rus vAb4G, the vUL43STOP mutant, and the vUL43STOP_R re-vertant on equine NBL6 cells. At the indicated times after infec-tion, extracellular and intracellular titers were determined. Withrespect to the production of virus progeny, there was no signifi-cant difference between the mutant virus lacking UL43 (ORF17)and the parental virus (Fig. 3A), suggesting that pUL43 is nones-sential for virus replication. In parallel, we analyzed the effects ofpUL43 on viral cell-to-cell spread by measuring plaque sizes. Theaverage diameter of plaques induced by vUL43STOP was �20%smaller than those of the parental virus (P � 0.05). Repair of thestop codon in pUL43 restored plaque formation to the morphol-ogy seen for the parental virus (Fig. 3B). These results demonstratethat pUL43 is nonessential for virus growth but is involved in virusspread between cells. Our findings are in agreement with datafrom previous studies on PRV and HSV-1, in which deletion ofUL43 proved dispensable for virus growth in vitro (24–26).

Determination of the pUL43 expression pattern and degra-dation in lysosomes. In previous reports on HSV-1 and PRVUL43 genes, mRNA was detected as early as 2 h p.i. even in thepresence of phosphonoacetic acid (PAA), an inhibitor of viralDNA synthesis (25, 27). However, the expression kinetics ofpUL43 throughout an infection cycle has not been addressed indetail. Detection of pUL43 homologues by SDS-PAGE and West-

ern blot analysis is complicated by the fact that they are predictedto be highly hydrophobic polypeptides, which presents problemsfor the design and generation of specific antibodies. After repeatedfailure to raise antibodies to EHV-1 pUL43, we decided to fuse anHA tag with the N terminus of the target protein. As mentionedabove, insertion of this epitope into the mutant virus (vHA-UL43)did not impair pUL43 function in MHC-I downregulation or vi-rus growth. In infected cells, the gene product of pUL43 was ex-pressed as a specific moiety of 34 kDa that could be detected from2 h p.i., and the amount of protein continued to increase until the8-h time point; afterwards, the levels of detectable protein beganto decline (Fig. 4A). The single band was considered specific, al-though its apparent molecular weight is considerably lower thanthe predicted Mr of 43,000. To determine the temporal class ofpUL43 expression, viral DNA synthesis was chemically inhibitedwith PAA, which substantially inhibited the expression of pUL43as well as the production of gM, which was used as a control. Incontrast, the levels of the product of the early IR6 gene were notaffected by PAA treatment (Fig. 4A). To determine whetherpUL43 is degraded at later times of infection, we used differentinhibitors to block the pathways responsible for the breakdown ofcellular proteins. Our results showed that expression levels ofpUL43 were stabilized when infected cells were incubated withchloroquine, an inhibitor of lysosomes. In contrast, lactacystin,which inhibits the proteasome, did not protect pUL43 from deg-radation (Fig. 4B). Next, a combination of PAA and chloroquinewas used to confirm whether pUL43 is indeed expressed with earlykinetics. Compared to treatment with PAA alone, treatment ofinfected cells with a combination of chloroquine and PAA resultedin increased levels of pUL43 in infected cells (Fig. 4C). From these

FIG 1 Schematic for virus mutagenesis and RFLP analysis of the infectious BAC mutants. (A) Parental EHV-1 strain Ab4 was derived from a BAC, which harborsan egfp gene driven by the HCMV IE promoter. UL, unique long region; US, unique short region; IR, internal repeats; TR, terminal repeats. (B to E) En passantmutagenesis was performed to generate the following mutants for the present study: UL43STOP, in which a stop codon, TAA, in the reverse direction wasintroduced into the ORF17 gene downstream of the second codon (B); HA-UL43, in which an HA tag (amino acid sequence YPYDVPDYA) was fused to the Nterminus of ORF17 (C); HA-N-UL43, in which amino acids 3 to 40 at the N terminus of ORF17 were deleted (D); and UL43STOP-UL56, a mutant based onour previously reported mutant Ab4G1 (11) with the introduction of a stop codon in the ORF17 gene, as described above (E). All mutants were confirmed byDNA sequencing. (F) Representative gel from RFLP analysis. DNA from the parental strain or the indicated BAC mutants was digested with SmaI or XhoI andseparated by electrophoresis using an 0.8% agarose gel. Changes in the digestion profile are consistent with those predicted in silico.

Downregulation of Cell Surface MHC-I by pUL43

June 2015 Volume 89 Number 12 jvi.asm.org 6255Journal of Virology

on May 19, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

data, we concluded that pUL43 is an early gene product and di-rected to the lysosomal pathway for degradation at later times ofinfection.

pUL43 is present in the Golgi vesicles and requires the trans-membrane domains at the C terminus for correct localization.As the intracellular distribution of pUL43 was poorly defined, weperformed indirect immunofluorescence microscopy to monitorthe pUL43 subcellular distribution. RK13 cell lines that constitu-tively express EGFP-conjugated �-1,4-galactosyltransferase orcalreticulin were generated by transfection and selection in thepresence of G418. Calreticulin and �-1,4-galactosyltransferase arecommonly used markers for the ER and Golgi compartments,respectively (28, 29). To avoid conflicts of EGFP signals duringvisualization, the mini-F cassette present in vHA-UL43 was ex-cised by Cre-mediated recombination, resulting in a modified vi-rus, vHA-UL43_M, that lacks EGFP expression in infected cells.RK13 cells expressing the individual compartment markers wereinfected with vHA-UL43_M. After reaction with anti-HA mono-

clonal antibody, pUL43 was found to predominantly localize tothe Golgi apparatus. Moreover, the Golgi complex seemed par-tially fragmented, and pUL43 became dispersed into vesicles ininfected cells (Fig. 5A). In contrast, pUL43 was not apparentlyassociated with structures that expressed the ER marker (Fig. 5B).In transiently transfected cells, pUL43 was still distributed in avesicular fashion, which is consistent with the observations of in-fected cells (Fig. 5D).

Structurally, the C terminus of the pUL43 homologue con-tains 4 putative TM domains, which are more conserved thanthose at the N terminus in terms of their relative positions ofamino acids. Additionally, two motifs, RxR and RLAA, wereidentified within the C terminus, which are conserved amongrelated viruses (Fig. 5C). When the protein was truncated bythe removal of these four predicted TM regions, the shortenedpUL43 protein appeared with a diffuse pattern in the cytoplasmafter transfection of an expression plasmid (Fig. 5D). Takentogether, these data demonstrated that pUL43 primarily local-

FIG 2 pUL43 induces downregulation of cell surface MHC-I. (A) Equine NBL6 cells were infected with vAb4G or vUL43STOP virus at an MOI of 3. At 6 h p.i.,cells were analyzed by flow cytometry after incubation with mouse anti-MHC-I (CZ3) MAb and Alexa Fluor 647-labeled goat anti-mouse IgG. Representative dotplots are derived from three independent experiments. (B) vAb4G, vUL43STOP, or vUL43STOP_R virus was used to infect NBL6 cells at an MOI of 3. SurfaceMHC-I levels were measured after 6 h p.i., as described above. (C) At 16 h p.i., HEK293 and HeLa cells infected with vAb4G or vUL43STOP virus were probedwith mouse anti-HLA class I (W6/32) MAb and subjected to flow cytometry. (D) NBL6 cells were exposed to infection with the vHA-UL43 mutant. At 6 h p.i.,cells were analyzed after incubation with mouse anti-MHC-I (CZ3) MAb and staining with Alexa Fluor 647-labeled goat anti-mouse IgG. All experiments wereindependently performed in triplicate and analyzed by using the Student t test. Data are presented as means � standard deviations (error bars). Asterisksrepresent statistical significance (P � 0.05). ns, not significant.

Huang et al.

6256 jvi.asm.org June 2015 Volume 89 Number 12Journal of Virology

on May 19, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

izes to the Golgi network and suggested that at least one of thefour predicted TM domains at the C terminus are required forcorrect subcellular localization.

The hydrophilic domain at the N terminus plays a criticalrole in MHC-I downregulation mediated by pUL43. The pUL43homologues of HSV-1 and PRV are predicted to represent type IIItransmembrane proteins (24, 25) (Fig. 5C). Apart from 10 puta-tive TM regions, the topology of EHV-1 pUL43 is characterized by

FIG 3 Effects of pUL43 on virus replication and cell-to-cell spread. (A) Single-step growth kinetics. NBL6 cells were infected with the parental virus vAb4G,vUL43STOP, or the vUL43STOP_R revertant at an MOI of 3. At the indicatedtimes following infection, supernatants and cell pellets were harvested for de-termination of extracellular and intracellular titers, respectively. Data are fromtriplicate measurements and expressed as means � standard deviations (errorbars). (B) Comparison of plaque sizes. Individual viruses were used to infectRK13 cells at an MOI of 0.0001 and overlaid with methylcellulose. Three daysafter infection, images of at least 80 plaques for each virus were acquired witha camera. The plaque diameter of vAb4G was set as 100%, and the relativeplaque sizes for other viruses were then calculated. A representative phenotypeof a viral plaque is shown (green). Statistical significance (P � 0.05) is indi-cated by the asterisk.

FIG 4 Determination of the pUL43 expression pattern and degradation bylysosomes. (A) Expression profile of pUL43 after infection. Cells were mockinfected or infected with vHA-UL43 at an MOI of 3 in the absence or presenceof PAA. Samples were harvested at different times postinfection. (B) Lyso-somes rather than proteasomes are responsible for degradation of pUL43.After infection, cells were maintained in culture medium supplemented with150 �M chloroquine or 5 �M lactacystin, respectively, for 12 h and 16 h. (C)pUL43 is an early gene product and subjected to lysosomal degradation duringinfection. Infected cells were treated with PAA, chloroquine, or both inhibitorsfor 12 h. To detect proteins, cell lysates were prepared in RIPA buffer. Afterseparation by SDS-12% PAGE, proteins were transferred onto PVDF mem-branes and incubated with anti-HA MAb, anti-gM MAb, or anti-pIR6 PAbs.The immunoblots were developed by enhanced chemiluminescence. �-Actinwas included as a loading control. Molecular mass markers were run for eachblot in parallel, and sizes are indicated in kilodaltons.

Downregulation of Cell Surface MHC-I by pUL43

June 2015 Volume 89 Number 12 jvi.asm.org 6257Journal of Virology

on May 19, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

FIG 5 Subcellular localization of pUL43 and role of TM domains at the C terminus. (A) Cells expressing EGFP-labeled �-1,4-galactosyltransferase, a Golgimarker (green). (B) Cells expressing EGFP-labeled calreticulin, an ER marker (green). The two cell lines were mock infected or infected with vHA-UL43_M virus.At 6 h p.i., samples were fixed with 3.5% PFA in PBS and then permeabilized with 0.1% Triton X-100. A confocal laser scanning microscope was used to visualizethe expression of pUL43 after sequential incubation with anti-HA MAb and Alex Fluor 568-conjugated goat anti-mouse IgG (red). Bar, 10 �m. (C) Domains ofpUL43 homologues and phylogenic analysis. Putative TM domains were predicted with SOSUI (http://harrier.nagahama-i-bio.ac.jp/sosui/sosui_submit.html).Identical amino acids are highlighted in black after multiple-sequence alignment with ClustalW 2.0 (http://www.ebi.ac.uk/Tools/msa/clustalw2). The RxR andRLAA motifs are underlined with solid and dotted lines, respectively. Sequences of pUL43 proteins were derived from GenBank, including EHV-1 (GenBankaccession number YP_053062), EHV-4 (accession number NP_045234), PRV (accession number AFI70808), VZV (accession number NP_040138), Marek’sdisease virus (MDV) (accession number YP_001033972), HSV-1 (AER37980), and HSV-2 (NP_044513) proteins. The phylogeny tree was constructed by usingthe unweighted-pair group method using average linkages, after 10,000 bootstraps were executed by using the MEGA 6.0 toolkit. The identity and similarity ofthe amino acid (aa) sequences were calculated by using the SIAS online tool with default settings (http://imed.med.ucm.es/Tools/sias.html). (D) Expression ofpUL43 and the truncated mutant lacking 4 TM domains at the C terminus. At 24 h after transfection with the indicated plasmids (green), cells were fixed andstained with DAPI (blue). Images were acquired by using an upright fluorescence microscope under a 100� oil objective. Bar, 5 �m.

Huang et al.

6258 jvi.asm.org June 2015 Volume 89 Number 12Journal of Virology

on May 19, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

a unique hydrophilic domain at its N terminus and an extremelyshort C-terminal domain. In addition, in silico analyses revealedthat no cleavable signal sequence is present, which led us to inves-tigate the possible involvement of the flexible domain in pUL43-mediated downregulation of MHC-I. Using en passant mutagen-esis, the region encompassing amino acids 3 to 40 was deleted,resulting in the vHA-N-UL43 mutant virus (Fig. 1D). In infectedcells, mutant pUL43 lacking the N terminus appeared more fo-cally localized and was present in fewer vesicles than the full-length protein (Fig. 6A). Flow cytometry showed that the expres-sion level of cell surface MHC-I was higher in cells infected withvHA-N-UL43 or vUL43STOP, whereas a dramatic reduction ofMHC-I levels was induced by vHA-UL43 (P � 0.05) (Fig. 6B).These results suggest that the hydrophilic N terminus is essentialfor the function of pUL43, possibly by modulating intracellularsorting and/or trafficking of pUL43.

pUL43 and pUL56 cooperate to downregulate cell surfaceMHC-I in transfected cells. Although pUL56 was shown to be aninhibitor of cell surface MHC-I presentation at early times ofEHV-1 infection, this effect could not be achieved by transfectionof a UL56 expression vector (11). As pUL43 and pUL56 sharesimilarities in terms of the intracellular localization and expres-sion patterns and the abrogation of both genes in one virus did nothave an additive effect (Fig. 1E and 7A), we hypothesized that thetwo proteins cooperate to trigger the downregulation of MHC-Imolecules. To test our hypothesis, an expression vector was con-structed, which allows expression of pUL43 and pUL56 from asingle vector. In addition, we introduced a self-cleavable EGFPmarker that was separated from pUL56 by a P2A sequence tofacilitate detection of transfected cells (Fig. 7B). We also replacedall PPxY motifs of pUL56 with AAxY elements, which resulted inthe pUL56(AY) mutant (Fig. 7C). At 24 h after transfection,pUL43 and pUL56 or pUL56(AY) were detectable by Westernblotting. As expected, some of the pUL56/UL56(AY)-P2A-EGFPprotein was not completely cleaved and migrated more slowly, asdetermined by SDS-PAGE (Fig. 7C). Expression of pUL43 orpUL56 individually did not induce downregulation of cell surface

MHC-I (Fig. 7D, left). However, a dramatic reduction of cell sur-face MHC-I molecules was observed in cells expressing both wild-type pUL43 and pUL56. In contrast, levels of cell surface MHC-Iremained stable in cells coexpressing pUL43 and pUL56(AY) (Fig.7D, middle). Cell surface levels of CD58, which was used as anegative control, were not affected by the expression of bothpUL43 and pUL56 (Fig. 7D, right). To further assess the cooper-ation of pUL43 and pUL56, we performed indirect immunofluo-rescence followed by confocal microscopy and found that pUL43colocalized with pUL56 in transfected as well as infected cells (Fig.7E). These results are consistent with the conclusion that pUL43cooperates with pUL56 to specifically induce the downregulationof MHC-I on the cell surface in transfected and infected cells.

DISCUSSION

Antagonizing the MHC-I presentation pathway is an effectivestrategy to achieve immune evasion and a result of the long coevo-lution of herpesviruses and their respective hosts. Different mem-bers of the Herpesviridae family encode a variety of viral proteinsto reduce MHC-I molecules on the cell surface, and they achievethis by exploiting diverse mechanisms. In the Alphaherpesvirinae,the ICP47 homologue of HSV-1 was the first protein identifiedthat blocks peptide binding by direct interaction with TAP (9).Likewise, the pUL49.5 homologues of the varicelloviruses, includ-ing bovine herpesvirus 1 (BoHV-1), PRV, EHV-1, and EHV-4,interfere with the activity of TAP by proteasomal degradationand/or by inhibiting the affinity of ATP for TAP (10, 12). It isnoted that ICP47 homologues are absent in varicelloviruses, butthe pUL49.5 homologue of HSV-1 cannot mediate MHC-I down-regulation (12), suggesting that suppression of the MHC-I path-way by a particular gene product can be restricted to specific vi-ruses and that it is not the action of an individual protein but theresult that is conserved. Moreover, the US3 kinases of VZV, PRV,and HSV-1 were also demonstrated to be necessary for inductionof the downregulation of MHC-I during productive infection(30–32). The mechanisms by which pUS3 homologues achievedownregulation vary greatly between viruses and were shown to

FIG 6 The hydrophilic domain at the N terminus plays a critical role in MHC-I downregulation mediated by pUL43. (A) Putative structures of pUL43 and itsmutant lacking the N-terminal 40 amino acids. The orientation of proteins was simulated by using SOSUI (http://harrier.nagahama-i-bio.ac.jp/sosui/sosui_submit.html). Cells were infected with vHA-UL43 or mutant vHA-N-UL43 virus. At 6 h p.i., cells were incubated with anti-HA MAb and visualized afterstaining with Alex Fluor 568-conjugated goat anti-mouse IgG (red) and DAPI (blue). Coverslips were inspected with a 100� oil objective. Bar, 5 �m. (B)vHA-UL43, vHA-N-UL43, or vUL43STOP was used to infect NBL6 cells for 6 h. Levels of cell surface MHC-I were measured by flow cytometry, and triplicateassays were performed independently. Data are expressed as means � standard deviations (error bars). Differences between various treatments were evaluatedby Student’s t test. The asterisk represents a significant level (P � 0.05). ns, no significant difference.

Downregulation of Cell Surface MHC-I by pUL43

June 2015 Volume 89 Number 12 jvi.asm.org 6259Journal of Virology

on May 19, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

be highly dependent on the particular cell type infected. There-fore, it is necessary to explore the entire repertoire of viral genesthat hold the potential of blocking MHC-I presentation based onthe virus species of interest.

In our previous studies, the pUL56 homologue of EHV-1 wasidentified as a novel viral protein that modulates the presentationof MHC-I molecules at the cell surface by accelerating dynamin-dependent endocytosis (15). However, pUL56 alone is not suffi-

FIG 7 Downregulation of MHC-I is induced by coexpression of pUL43 and pUL56 in transfected cells. (A) Deletion of both pUL43 and pUL56 does not induce anadditional increase of MHC-I expression. NBL6 cells were infected with individual viral mutants at an MOI of 3. At 6 h p.i., levels of cell surface MHC-I were measuredby flow cytometry. There is no significant difference between single- and double-deletion mutants. The asterisk indicates statistical significance (P � 0.05). (B) Strategyof engineering the coexpression vectors with a self-cleavable EGFP marker. The P2A sequence was inserted between pUL56 and EGFP. The fragment of pUL56-P2A-EGFP was subcloned into the pVITRO-UL43 vector after digestion with BamHI and XbaI. (C) Sequence alignment and detection of the coexpression vectors. Mutationsare highlighted in boldface italic type. HEK293 cells were transfected with the indicated vectors. At 24 h, expression of individual genes was detected by immunoblotting(IB) following incubation with anti-HA MAb and anti-pUL56 PAbs, respectively. �-Actin was used as a loading control. (D) Downregulation of MHC-I caused bypUL43 and pUL56. HEK293 cells were transfected with 500 ng of different expression plasmids. At 24 h, cells were harvested and processed for flow cytometry analysis.Anti-HLA class I MAb (W6/32) was used to react with cell surface MHC-I. CD58 was included as a negative control. Representative histograms are from threeindependent assays. (E) Colocalization of pUL43 with pUL56. (Top) HEK293 cells were transfected with plasmid pUL43-pUL56-P2A-EGFP for 24 h. (Bottom) NBL6cells were infected with vHA-UL43 virus for 6 h. Samples were fixed with ice-cold acetone until the EGFP fluorescence was quenched. After reaction with anti-HA MAband anti-pUL56 PAbs, the coverslips were stained with Alexa Fluor 488-labeled goat anti-mouse IgG (green) and Alexa Fluor 568-labeled goat anti-rabbit IgG (red).Images were captured by a confocal microscope with a 60� oil objective. Bar, 10 �m.

Huang et al.

6260 jvi.asm.org June 2015 Volume 89 Number 12Journal of Virology

on May 19, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

cient to induce the downregulation of MHC-I, as it did so only inthe context of viral infection, implying that either a direct or indi-rect interaction of a viral protein(s) with pUL56 is required forMHC-I depletion. To test this hypothesis, we screened a single-gene knockout library of EHV-1 and focused on genes that werepredicted to be nonessential for virus growth and not well definedwith respect to function. These efforts led to the identification of aviral ORF17 gene encoding the pUL43 homologue that we thenshowed to be involved in the downregulation of MHC-I at earlytimes of infection, coinciding with the time when pUL56 wasshown to exert its function.

Given that this is the first description of EHV-1 pUL43, wecharacterized its role in virus growth and examined its expressionpattern and subcellular localization. We found that the insertionof a stop codon within the open reading frame of pUL43 had littleeffect on virus growth in vitro and only mildly inhibited virusspread between cells. These findings on EHV-1 pUL43 are inagreement with findings for its counterparts in HSV-1 and PRV(24–26). Due to the difficulty in the generation of specific anti-bodies, the expression profiles of pUL43 homologues have notbeen well determined, and most of the available studies focusedonly on the detection of mRNA transcripts. Treatment with PAAto inhibit viral DNA synthesis revealed that mRNA transcripts ofpUL43 homologues in HSV-1 and PRV are produced with earlykinetics and are detectable as early as 2 h p.i. (25, 27). However,our expression kinetics showed that the production of pUL43 incells after EHV-1 infection was reduced when viral DNA synthesiswas blocked, suggesting that pUL43 could also be expressed as alate protein. However, in light of our observation that the pUL43protein is degraded in lysosomes at later times of infection, wecurrently surmise that pUL43 represents a bona fide early and nota late protein and that the reduced expression levels under PAAtreatment are a result of degradation. This conclusion is sup-ported by an experiment in which the addition of lysosome inhib-itors resulted in levels of pUL43 that were only marginally affectedin the presence of PAA (Fig. 4C). It is noteworthy that EHV-1pUL43 is expressed as a single species without any detectable post-translational modifications, regardless of infection or transfec-tion; however, the protein migrates faster than predicted from itspredicted molecular weight. This anomalous mobility, as assessedafter SDS-PAGE, is commonly seen in all studied pUL43 homo-logues (26, 27). A reasonable interpretation of this migrationanomaly is that pUL43 exhibits extraordinary hydrophobicityand, consequently, may not be fully accessible to the detergent(33). In this case, nondenatured pUL43 protein could aggregateand migrate with a mobility that is faster than expected. This ab-normal mobility would certainly make it difficult to identify post-translational modifications, including ubiquitination.

Phylogenic analysis predicts that pUL43 homologues are con-served in the Alphaherpesvirinae (26). pUL43 homologues com-monly consist of multiple TM regions but have various numbersof TM domains and share low amino acid identity (Fig. 5C). Toascertain the intracellular localization of pUL43, we applied con-focal microscopy and observed that pUL43 is located primarily atthe Golgi apparatus, which appears to be critically dependenton the most conserved TM domains at the C terminus of theprotein. The pUL43 homologue of PRV is present in vesicles andinhibits syncytium formation, indicating that it might be involvedin the trafficking of membrane proteins and vesicles (26). Consis-tent with this localization, PRV pUL43 is incorporated into viri-

ons, which was also shown for the EHV-1 homologue (AntonieNeubauer-Juric, personal communication). The Golgi apparatusis an organelle that directs sorting and trafficking of proteins (34,35), such as mature MHC-I. Evidenced by the localization ofpUL56 to the Golgi network and its role in inhibiting MHC-Ipresentation (11), it is conceivable that localization of viral pro-teins to the Golgi compartment to obstruct MHC-I presentationwould be an optimal strategy for immune evasion. Our currentmodel predicts that, similar to pUL56, pUL43 is targeted to Golgiand endocytic vesicles. To this end, pUL43 specifies two pivotaldomains. First, the association of pUL43 with the Golgi complex ismaintained by the TM domains at the C terminus; second, theN-terminal hydrophilic domain determines the localization invesicles that are involved in directing the intracellular transport ofMHC-I molecules.

Although both pUL56 and pUL43 are Golgi-associated viralproteins, neither of them is able to cause downregulation ofMHC-I independently. Arguably, the most significant finding ofthis report is our demonstration that pUL43 and pUL56 collabo-rate in decreasing the amount of cell surface MHC-I molecules(Fig. 7). This process requires the PPxY motifs present in the cy-toplasmic domain of the type II transmembrane protein pUL56.Similar to HSV-2 pUL56 (36), the mutated EHV-1 protein alsomigrated faster, as assessed by SDS-PAGE, when AAxY motifs wereintroduced instead of PPxY (Fig. 7C). We cannot exclude the possi-bility that pUL56 is structurally altered, but we currently surmise thatthe change in mobility is caused by a difference in electric charge. Likethe HSV-2 orthologue, this change may also be triggered by the pre-sumably absent interaction between pUL56 and Nedd4. Due to tech-nical limitations, we did not further investigate the mechanisms thatregulate MHC-I reduction after cotransfection of pUL43 and pUL56,but we favor a model in which pUL43 and pUL56 orchestrate thesorting of MHC-I to and its degradation in endolysosomes, which isbased mainly on the colocalization of pUL43 and pUL56 (Fig. 7E)and the following previously reported experimental evidence: (i)PPxY motifs are required for the interaction of pUL56 with the cellu-lar E3 ubiquitin ligase Nedd4 (36); (ii) trafficking of viral proteinscontaining PPxY motifs toward the endolysosomal pathway requiresNedd4.1-mediated ubiquitination and recruitment of TSG101, acomponent of ESCRT-1 (endosomal sorting complex required fortransport) (37); and (iii) Nedd4 is known to ubiquitinate proteinswith multiple transmembrane domains, such as ion channels,thereby facilitating endocytosis and degradation (38). It is conceiv-able that pUL43 is modified similarly and acts as an adaptor forMHC-I endocytosis where pUL56 is the recruiter for Nedd4. Thisinterpretation is supported at least by the colocalization of pUL56 andMHC-I in the Golgi and endosomal vesicles during EHV-1 infection(15).

It has been shown that EHV-1 strains differ in their poten-tial to reduce cell surface MHC-I expression. Infection with theAb4 strain caused a severe downregulation of MHC-I mole-cules, while the levels of surface MHC-I were moderately re-duced by infection with the RacL11 strain (11). This differencein the modulation of MHC-I largely depends on the presence ofpUL56, but our results demonstrate that pUL43 and pUL56cooperate to decrease the expression of cell surface MHC-Iboth during virus infection and after transient transfection. Wesurmise that EHV-1 strains, which contain full-length pUL43and pUL56, are likely to cause MHC-I downregulation throughinteraction of the two proteins. In contrast, RacL11 or other

Downregulation of Cell Surface MHC-I by pUL43

June 2015 Volume 89 Number 12 jvi.asm.org 6261Journal of Virology

on May 19, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

strains lacking pUL56 and/or pUL43 are unable to adopt thisimmune evasion strategy. Apart from MHC-I, a variety of cellsurface molecules might be affected by the cooperation ofpUL43 with pUL56, as pUL56 was recently shown to modulatea selection of cell surface markers in equine mesenchymal stemcells after EHV-1 infection (39). In the future, we will addressquestions on the involvement of pUL43 in MHC-I downregu-lation by various EHV-1 strains and the spectrum and func-tional consequences of the pUL43-pUL56 interaction.

In summary, our present study identified a new function forthe poorly understood pUL43 homologue of EHV-1. pUL43 hasan important role in modulating MHC-I presentation, although itis dispensable for virus growth and is subjected to lysosomal deg-radation in the course of infection. Interestingly, the combinationof pUL56 and pUL43 induces the downregulation of cell surfaceMHC-I independently of viral infection. Our findings open a newaspect of the complex landscape of viral immune evasion and mayprovide useful insights into the rational design of immunothera-pies against EHV-1 infection.

ACKNOWLEDGMENTS

We are grateful to Douglas F. Antczak (Cornell University) for his gener-ous supply of anti-MHC-I (CZ3) MAb. We also appreciate Maik J. Leh-mann and Walid Azab for assistance in confocal imaging.

T.H. received financial support from the China Scholarship Council(CSC). The study was supported by DFG grant OS143/3-1 awarded toN.O.

REFERENCES1. Gao G, Luo H. 2006. The ubiquitin-proteasome pathway in viral infections.

Can J Physiol Pharmacol 84:5–14. http://dx.doi.org/10.1139/y05-144.2. Neefjes J, Jongsma ML, Paul P, Bakke O. 2011. Towards a systems

understanding of MHC class I and MHC class II antigen presentation. NatRev Immunol 11:823– 836. http://dx.doi.org/10.1038/nri3084.

3. Zhang N, Bevan MJ. 2011. CD8(�) T cells: foot soldiers of the immunesystem. Immunity 35:161–168. http://dx.doi.org/10.1016/j.immuni.2011.07.010.

4. Hansen TH, Bouvier M. 2009. MHC class I antigen presentation: learningfrom viral evasion strategies. Nat Rev Immunol 9:503–513. http://dx.doi.org/10.1038/nri2575.

5. Ma G, Azab W, Osterrieder N. 2013. Equine herpesviruses type 1(EHV-1) and 4 (EHV-4)—masters of co-evolution and a constant threatto equids and beyond. Vet Microbiol 167:123–134. http://dx.doi.org/10.1016/j.vetmic.2013.06.018.

6. Telford EA, Watson MS, McBride K, Davison AJ. 1992. The DNAsequence of equine herpesvirus-1. Virology 189:304 –316. http://dx.doi.org/10.1016/0042-6822(92)90706-U.

7. Telford EA, Watson MS, Perry J, Cullinane AA, Davison AJ. 1998. TheDNA sequence of equine herpesvirus-4. J Gen Virol 79(Part 5):1197–1203.

8. Klupp BG, Hengartner CJ, Mettenleiter TC, Enquist LW. 2004. Com-plete, annotated sequence of the pseudorabies virus genome. J Virol 78:424 – 440. http://dx.doi.org/10.1128/JVI.78.1.424-440.2004.

9. Fruh K, Ahn K, Djaballah H, Sempe P, van Endert PM, Tampe R, PetersonPA, Yang Y. 1995. A viral inhibitor of peptide transporters for antigen pre-sentation. Nature 375:415–418. http://dx.doi.org/10.1038/375415a0.

10. Koppers-Lalic D, Verweij MC, Lipinska AD, Wang Y, Quinten E, ReitsEA, Koch J, Loch S, Marcondes Rezende M, Daus F, Bienkowska-Szewczyk K, Osterrieder N, Mettenleiter TC, Heemskerk MH, TampeR, Neefjes JJ, Chowdhury SI, Ressing ME, Rijsewijk FA, Wiertz EJ.2008. Varicellovirus UL 49.5 proteins differentially affect the function ofthe transporter associated with antigen processing, TAP. PLoS Pathog4:e1000080. http://dx.doi.org/10.1371/journal.ppat.1000080.

11. Ma G, Feineis S, Osterrieder N, Van de Walle GR. 2012. Identificationand characterization of equine herpesvirus type 1 pUL56 and its role invirus-induced downregulation of major histocompatibility complex classI. J Virol 86:3554 –3563. http://dx.doi.org/10.1128/JVI.06994-11.

12. Koppers-Lalic D, Reits EA, Ressing ME, Lipinska AD, Abele R, KochJ, Marcondes Rezende M, Admiraal P, van Leeuwen D, Bienkowska-Szewczyk K, Mettenleiter TC, Rijsewijk FA, Tampe R, Neefjes J,Wiertz EJ. 2005. Varicelloviruses avoid T cell recognition by UL49.5-mediated inactivation of the transporter associated with antigen pro-cessing. Proc Natl Acad Sci U S A 102:5144 –5149. http://dx.doi.org/10.1073/pnas.0501463102.

13. Wei H, Wang Y, Chowdhury SI. 2011. Bovine herpesvirus type 1(BHV-1) UL49.5 luminal domain residues 30 to 32 are critical for MHC-Idown-regulation in virus-infected cells. PLoS One 6:e25742. http://dx.doi.org/10.1371/journal.pone.0025742.

14. Rudolph J, Seyboldt C, Granzow H, Osterrieder N. 2002. The gene 10(UL49.5) product of equine herpesvirus 1 is necessary and sufficient forfunctional processing of glycoprotein M. J Virol 76:2952–2963. http://dx.doi.org/10.1128/JVI.76.6.2952-2963.2002.

15. Huang T, Lehmann MJ, Said A, Ma G, Osterrieder N. 2014. Majorhistocompatibility complex class I downregulation induced by equineherpesvirus type 1 pUL56 is through dynamin-dependent endocytosis. JVirol 88:12802–12815. http://dx.doi.org/10.1128/JVI.02079-14.

16. Goodman LB, Loregian A, Perkins GA, Nugent J, Buckles EL, Mercorelli B,Kydd JH, Palu G, Smith KC, Osterrieder N, Davis-Poynter N. 2007. A pointmutation in a herpesvirus polymerase determines neuropathogenicity. PLoSPathog 3:e160. http://dx.doi.org/10.1371/journal.ppat.0030160.

17. Azab W, Kato K, Arii J, Tsujimura K, Yamane D, Tohya Y, MatsumuraT, Akashi H. 2009. Cloning of the genome of equine herpesvirus 4 strainTH20p as an infectious bacterial artificial chromosome. Arch Virol 154:833– 842. http://dx.doi.org/10.1007/s00705-009-0382-0.

18. Osterrieder N, Holden VR, Brandmuller C, Neubauer A, Kaaden OR,O’Callaghan DJ. 1996. The equine herpesvirus 1 IR6 protein is nonessentialfor virus growth in vitro and modified by serial virus passage in cell culture.Virology 217:442–451. http://dx.doi.org/10.1006/viro.1996.0138.

19. Osterrieder N, Neubauer A, Brandmuller C, Braun B, Kaaden OR,Baines JD. 1996. The equine herpesvirus 1 glycoprotein gp21/22a, theherpes simplex virus type 1 gM homolog, is involved in virus penetrationand cell-to-cell spread of virions. J Virol 70:4110 – 4115.

20. Osterrieder N. 1999. Construction and characterization of an equineherpesvirus 1 glycoprotein C negative mutant. Virus Res 59:165–177. http://dx.doi.org/10.1016/S0168-1702(98)00134-8.

21. Tischer BK, von Einem J, Kaufer B, Osterrieder N. 2006. Two-stepred-mediated recombination for versatile high-efficiency markerless DNAmanipulation in Escherichia coli. Biotechniques 40:191–197. http://dx.doi.org/10.2144/000112096.

22. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a labora-tory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Har-bor, NY.

23. Kim JH, Lee SR, Li LH, Park HJ, Park JH, Lee KY, Kim MK, Shin BA,Choi SY. 2011. High cleavage efficiency of a 2A peptide derived fromporcine teschovirus-1 in human cell lines, zebrafish and mice. PLoS One6:e18556. http://dx.doi.org/10.1371/journal.pone.0018556.

24. MacLean CA, Efstathiou S, Elliott ML, Jamieson FE, McGeoch DJ.1991. Investigation of herpes simplex virus type 1 genes encoding multiplyinserted membrane proteins. J Gen Virol 72(Part 4):897–906.

25. Powers L, Wilkinson KS, Ryan P. 1994. Characterization of the prv43gene of pseudorabies virus and demonstration that it is not required forvirus growth in cell culture. Virology 199:81– 88. http://dx.doi.org/10.1006/viro.1994.1099.

26. Klupp BG, Altenschmidt J, Granzow H, Fuchs W, Mettenleiter TC.2005. Identification and characterization of the pseudorabies virus UL43protein. Virology 334:224 –233. http://dx.doi.org/10.1016/j.virol.2005.01.032.

27. Carter KL, Ward PL, Roizman B. 1996. Characterization of the productsof the U(L)43 gene of herpes simplex virus 1: potential implications forregulation of gene expression by antisense transcription. J Virol 70:7663–7668.

28. Russo RN, Shaper NL, Taatjes DJ, Shaper JH. 1992. Beta 1,4-galactosyltransferase: a short NH2-terminal fragment that includes the cyto-plasmic and transmembrane domain is sufficient for Golgi retention. J BiolChem 267:9241–9247.

29. Gelebart P, Opas M, Michalak M. 2005. Calreticulin, a Ca2�-bindingchaperone of the endoplasmic reticulum. Int J Biochem Cell Biol 37:260 –266. http://dx.doi.org/10.1016/j.biocel.2004.02.030.

30. Eisfeld AJ, Yee MB, Erazo A, Abendroth A, Kinchington PR. 2007.Downregulation of class I major histocompatibility complex surface ex-

Huang et al.

6262 jvi.asm.org June 2015 Volume 89 Number 12Journal of Virology

on May 19, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

pression by varicella-zoster virus involves open reading frame 66 proteinkinase-dependent and -independent mechanisms. J Virol 81:9034 –9049.http://dx.doi.org/10.1128/JVI.00711-07.

31. Deruelle MJ, Van den Broeke C, Nauwynck HJ, Mettenleiter TC,Favoreel HW. 2009. Pseudorabies virus US3- and UL49.5-dependent and-independent downregulation of MHC I cell surface expression in differ-ent cell types. Virology 395:172–181. http://dx.doi.org/10.1016/j.virol.2009.09.019.

32. Imai T, Koyanagi N, Ogawa R, Shindo K, Suenaga T, Sato A, Arii J,Kato A, Kiyono H, Arase H, Kawaguchi Y. 2013. Us3 kinase encoded byherpes simplex virus 1 mediates downregulation of cell surface major his-tocompatibility complex class I and evasion of CD8� T cells. PLoS One8:e72050. http://dx.doi.org/10.1371/journal.pone.0072050.

33. Nybo K. 2012. Molecular biology techniques Q&A. Western blot: pro-tein migration. Biotechniques 53:23–24. http://dx.doi.org/10.2144/000113887.

34. Joyce S. 1997. Traffic control of completely assembled MHC class I mol-ecules beyond the endoplasmic reticulum. J Mol Biol 266:993–1001. http://dx.doi.org/10.1006/jmbi.1996.0822.

35. Fullekrug J, Nilsson T. 1998. Protein sorting in the Golgi complex.

Biochim Biophys Acta 1404:77– 84. http://dx.doi.org/10.1016/S0167-4889(98)00048-2.

36. Ushijima Y, Koshizuka T, Goshima F, Kimura H, Nishiyama Y. 2008.Herpes simplex virus type 2 UL56 interacts with the ubiquitin ligaseNedd4 and increases its ubiquitination. J Virol 82:5220 –5233. http://dx.doi.org/10.1128/JVI.02515-07.

37. Blot V, Perugi F, Gay B, Prevost MC, Briant L, Tangy F, Abriel H, StaubO, Dokhelar MC, Pique C. 2004. Nedd4.1-mediated ubiquitination andsubsequent recruitment of Tsg101 ensure HTLV-1 Gag trafficking to-wards the multivesicular body pathway prior to virus budding. J Cell Sci117:2357–2367. http://dx.doi.org/10.1242/jcs.01095.

38. Bongiorno D, Schuetz F, Poronnik P, Adams DJ. 2011. Regulation ofvoltage-gated ion channels in excitable cells by the ubiquitin ligases Nedd4and Nedd4-2. Channels (Austin) 5:79–88. http://dx.doi.org/10.4161/chan.5.1.13967.

39. Claessen C, Favoreel H, Ma G, Osterrieder N, De Schauwer C, PiepersS, Van de Walle GR. 2015. Equid herpesvirus 1 (EHV1) infection ofequine mesenchymal stem cells induces a pUL56-dependent downregula-tion of select cell surface markers. Vet Microbiol 176:32–39. http://dx.doi.org/10.1016/j.vetmic.2014.12.013.

Downregulation of Cell Surface MHC-I by pUL43

June 2015 Volume 89 Number 12 jvi.asm.org 6263Journal of Virology

on May 19, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from