Page 1 of 49 Diabetes...Aug 21, 2018 · substrates ex vivo, Krebs-Henseleit buffer (KHB) was supplemented with GLP-1 (10nM ... Images were acquired using a Rolera MGi plus EMCCD

The dipeptidyl peptidase-4 substrate CXCL12 has opposing cardiac effects in young mice

and aged diabetic mice mediated by Ca2+ flux and phosphoinositide 3 kinase γγγγ

Sri N. Batchu1, Karina Thieme

1, Farigol H. Zadeh

2,3, Tamadher A. Alghamdi

1, Veera Ganesh

Yerra1, Mitchell J. Hadden

1, Syamantak Majumder

1, M. Golam Kabir

1, Bridgit B. Bowskill

1,

Danyal Ladha1, Anthony O. Gramolini

2,3, Kim A. Connelly

1, Andrew Advani

1

1Keenan Research Centre for Biomedical Science and Li Ka Shing Knowledge Institute, St.

Michael’s Hospital, Toronto, ON, Canada; 2Department of Physiology, University of Toronto,

Toronto, ON, Canada; 3Ted Rogers Centre for Heart Research, University of Toronto, Toronto,

ON, Canada

Address for correspondence: Dr. Andrew Advani

Associate Professor/Clinician Scientist

St. Michael’s Hospital

6-151 61 Queen Street East

Toronto, Ontario, Canada, M5C 2T2

Tel: 416 864 6060 x8413

Fax: 416 867 3696

Email: [email protected]

Running title: Cardiac actions of DPP-4 substrates; Word count 4,604 words; Total number of

figures 8; Total number of supplementary tables 8; Total number of supplementary figures 1

K.T.’s present address is: Institute of Biomedical Sciences, Department of Physiology and

Biophysics, University of São Paulo, São Paulo, Brazil. S.M.’s present address is: Department

of Biological Sciences, Birla Institute of Technology and Sciences (BITS), Pilani, Rajasthan,

India.

Page 1 of 49 Diabetes

-

Diabetes Publish Ahead of Print, published online August 27, 2018

2

ABSTRACT

Blood glucose lowering therapies can positively or negatively affect heart function in Type 2

diabetes, or they can have neutral effects. Dipeptidyl peptidase-4 (DPP-4) inhibitors lower blood

glucose by preventing the proteolytic inactivation of glucagon-like peptide-1 (GLP-1).

However, GLP-1 is not the only peptide substrate of DPP-4. Here, we investigated the GLP-1

independent cardiac effects of DPP-4 substrates. Pointing to GLP-1 receptor (GLP-1R)

independent actions, DPP-4 inhibition prevented systolic dysfunction equally in pressure

overloaded wildtype and GLP-1R knockout mice. Likewise, DPP-4 inhibition or the DPP-4

substrates, substance P or CXCL12 improved contractile recovery following no-flow ischemia in

the hearts of otherwise healthy young adult mice. Either DPP-4 inhibition or CXCL12 increased

phosphorylation of the Ca2+

regulatory protein, phospholamban and CXCL12 directly enhanced

cardiomyocyte Ca2+

flux. In contrast, hearts of aged, obese diabetic mice (which may better

mimic the comorbid patient population) had diminished levels of phospholamban

phosphorylation. In this setting, CXCL12 paradoxically impaired cardiac contractility in a

phosphoinositide 3-kinase γ dependent manner. These findings indicate that the cardiac effects

of DPP-4 inhibition primarily occur through GLP-1R independent processes and that ostensibly

beneficial DPP-4 substrates can paradoxically worsen heart function in the presence of comorbid

diabetes.

Page 2 of 49Diabetes

3

Historically overlooked, heart failure is now firmly recognized as being a major long-term

complication of diabetes. On the one hand, diabetes confers an increased risk of heart failure (1).

On the other hand, whereas certain medications used in the treatment of diabetes may reduce the

risk of heart failure (2), others are neutral (3) and some actually increase heart failure risk (4). In

the case of the dipeptidyl peptidase-4 (DPP-4) inhibitor class of anti-hyperglycemic medication

some DPP-4 inhibitors have demonstrated neutrality (e.g. sitagliptin) (3), whereas one

(saxagliptin) was associated with an unexpected increase in risk of hospitalization for heart

failure (5) and another (alogliptin) was associated with a numerical, albeit non-significant,

increase in heart failure risk (6). These observations are generally discordant with most

preclinical studies that have reported overall favorable cardiac effects of various DPP-4

inhibitors (reviewed in (7)).

DPP-4 inhibitors lower blood glucose levels by preventing the enzymatic degradation of the gut

hormones, glucagon-like peptide-1 (GLP-1) and gastric inhibitory polypeptide (GIP) by DPP-4,

a serine exopeptidase. DPP-4 acts by catalyzing the hydrolysis of N-terminal dipeptides from

polypeptides that contain either an alanine or a proline residue at position two. However, GLP-1

and GIP are not the only peptides that possess this amino acid configuration and, as a result,

DPP-4 inhibitors have the capacity to increase the biological activity of a number of other

peptide substrates. Although non-GLP-1 peptide substrates of DPP-4 may not regulate glucose

homeostasis some, such as substance P (8) and C-X-C motif chemokine ligand 12 (CXCL12,

stromal cell-derived factor-1α (SDF-1α)) (9), may play important roles in cardiovascular

(patho)physiology. The increased biological activity of these alternative substrates has been

proposed as mediating some of the cardiovascular effects of DPP-4 inhibitors (10). However, in


4

most cases it has not been possible to discern whether the effects of DPP-4 inhibition on

cardiovascular function are mediated by conventional GLP-1 receptor (GLP-1R)-dependent

processes or by alternative DPP-4 substrates.

Here, we hypothesized that the cardiac effects of DPP-4 inhibition are mediated by mechanisms

that do not involve classical GLP-1R mediated events. During the course of our studies we

became mindful of the historical discordance between the effects of DPP-4 inhibition in

experimental rodents and in clinical trials. Accordingly, we went on to compare the effects of

DPP-4 substrates in the hearts of young adult mice, that are typically employed in preclinical

studies, with older obese diabetic mice that may better reflect the comorbid condition of the

patient populations typically studied in cardiovascular outcome trials. Through this comparison,

we discovered a dichotomous effect of the DPP-4 peptide substrate CXCL12, enhancing calcium

(Ca2+

) handling and improving contractility in young hearts but paradoxically impairing cardiac

contractility in aged diabetic hearts in a phosphoinositide 3-kinase γ (PI3Kγ)-dependent manner.


5

RESEARCH DESIGN AND METHODS

Dipeptidyl peptidase-4 activity

Plasma DPP-4 activity was determined in wildtype (C57BL/6) mice treated with either normal

chow or linagliptin (0.083g/kg (11)) in chow (Harlan laboratories Inc., Madison, WI), or in the

hearts of diabetic high fat diet-fed (DM-HFD) mice, as previously described (12).

Transverse aortic constriction (TAC) study

GLP-1R-/-

mice were provided by Dr. Daniel J. Drucker at University of Toronto (13). Male

wildtype (C57BL/6) and GLP-1R knockout (GLP-1R-/-

) mice (aged 6-13 weeks) were bred at

Charles River (Sulzfeld, Germany) and they were studied at St. Michael’s Hospital (Toronto,

Ontario, Canada). TAC (or sham) surgery was conducted as previously described (14). Briefly,

a thoracotomy was performed in the second left intercostal space, the aorta was cleared distal to

the subclavian artery and a 7-0 silk suture was used to constrict the aortic arch. Sham surgery

consisted of thoracotomy without placement of an aortic suture. Following TAC surgery, mice

were randomly allocated to receive either linagliptin in chow (0.083g/kg) (11) or chow alone and

they were followed for eight weeks. HbA1c was determined using A1cNow+ (Roxon medi-tech

ltd., Etobicoke, Ontario, Canada). After eight weeks, transthoracic echocardiography was

performed using a high-frequency ultrasound system (Vevo 2100, MS-250 transducer;

VisualSonics Inc., Toronto, Ontario, Canada) and linear dimensions were analyzed offline (Vevo

2100 software v. 1.8) by a single investigator masked to the treatment groups. At sacrifice, mice

were anesthetized, intubated and artificially ventilated. Left ventricular cardiac catheterization

was performed through the right internal carotid artery (Millar Mikro-Tip, 1.4F; AD Instruments,


6

Colorado Springs, CO) (15). Data were acquired and analyzed using LabChart Pro (AD

Instruments).

Isolated heart perfusions

Hearts from wildtype (C57BL/6) mice were perfused using a retrograde isolated perfusion

technique as described previously (16). For determination of the effects of DPP-4 peptide

substrates ex vivo, Krebs-Henseleit buffer (KHB) was supplemented with GLP-1 (10nM (17;

18); Bachem, Bubendorf, Switzerland), GLP-2 (10nM (19); Prospec Technologies Inc.,

Mississauga, Ontario, Canada), GIP (10nM (20); Phoenix Pharmaceuticals Inc., Burlingame,

CA), substance P (1µM (21); Tocris Bioscience, Bristol, UK) or CXCL12 (25nM (22);

Shenandoah Biotechnology Inc., Warwick, PA) throughout the procedure. For inhibition of

PI3Kγ, hearts from DM-HFD mice were perfused with IPI-549 (30nM, Chemietek, Indianapolis,

IN) and contractility and heart rate parameters were measured after 20 minutes. The cellular IC50

for IPI-549 is 1.2nM (vs. 250nM for PI3Kα, 240nM for PI3Kß and 180nM for PI3Kδ) (23). Left

ventricular developed pressure (LVDP), maximum and minimum dP/dt and heart rate were

collected and analyzed using PowerLab 8/35 and LabChart Pro (AD Instruments).

High fat diet-fed diabetic mice studies

Male C57BL/6 mice aged eight weeks were obtained from Charles River Laboratories

(Montreal, Quebec, Canada) and placed on a high fat diet (45% kcal fat, 35% kcal carbohydrate,

0.05% wt/wt cholesterol; Research Diets Inc., New Brunswick, NJ). After 12 weeks, mice

received a single intraperitoneal injection of streptozotocin (STZ; 90mg/kg in 0.1M sodium

citrate, pH 4.5). Diabetes was confirmed two weeks after STZ injection by blood glucose testing


7

(One Touch UltraMini, LifeScan Canada Ltd., Burnaby, BC, Canada) and mice that were not

diabetic (blood glucose <12mmol/L) received a second dose of STZ. Animals were followed for

a total of 26 weeks before hearts were harvested for perfusion in the Langendorff mode.

All experimental procedures adhered to the guidelines of the Canadian Council on Animal Care

and were approved by the St. Michael’s Hospital Animal Care Committee.

Myocyte hypertrophy, nuclear volume and picrosirius red staining

Cardiac myocyte hypertrophy was determined on hematoxylin and eosin (H&E) stained

sections as previously reported (15; 24) and using a method adapted from Frustaci et al (25).

Nuclear volume was determined in 50 cardiomyocytes on each H&E stained sections using a

method adapted from Gerdes et al in which nuclear volume is considered to be that of a

prolate ellipsoid (26). Picrosirius red-stained sections of the left ventricular myocardium were

scanned (Leica Microsystems Inc., Concord, Ontario, Canada) and quantified as the

proportion of positive red staining in 10 randomly chosen fields (x20 magnification) using

ImageScope (Leica Microsystems Inc.).

Quantitative reverse transcriptase PCR (qRT-PCR)

SYBR green based qRT-PCR was performed on a ViiA7 Real-Time PCR System (ThermoFisher

Scientific, Rockford, IL). Primer sequences are listed in Supplemental Table 1. Data analysis

was performed using Applied Biosystems Comparative CT method.

Immunoblotting


8

Immunoblotting was performed with antibodies in the following concentrations: phosphorylated

phospholamban (phospho-PLN) (Ser16) 1:1000 (A285 (27)), phospholamban (1D11 (28)),

SERCA2a 1:1000 (IID8F6 (29)), phospho-PLN (Thr17) 1:1000 (sc-17024-R, Santa Cruz

Biotechnology, Dallas, TX), p110γ 1:1000 (sc-166365, Santa Cruz Biotechnology), GAPDH

1:5000 (sc-25778, Santa Cruz Biotechnology). Densitometry was performed using Image J

version 1.39 (National Institutes of Health, Bethesda, MD).

Adult mouse cardiomyocyte isolation and Ca2+ transients measurement

Adult mouse cardiac myocytes were isolated following the protocol developed by Ackerson-

Johnson et al (30). Cells were loaded with 1µM Fura-2AM (ThermoFisher Scientific) and

placed under an Olympus IX81 fluorescence microscope (Tokyo, Japan) with an X-cite 120Q

light source (EXFO, Quebec City, Quebec, Canada; Fura 2B filter set from Semrock, Rochester,

NY). Fura-2AM was excited using single-band excitation (387nm) and emission was recorded

with a single-band filter (510nm). Images were acquired using a Rolera MGi plus EMCCD

camera (QImaging, Surrey, British Columbia, Canada) and analyzed with MetaMorph v7.6.6

software (MetaMorph, Nashville, TN). Cardiac myocytes were stimulated at 5V with a

frequency of 1Hz. After taking control readings, cells were treated with 25nM CXCL12

(Shenandoah Biotechnology Inc.). Ca2+

transients were calculated from 200 frames taken over

one minute.

Phosphodiesterase activity

Phosphodiesterase (PDE) activity was determined in heart homogenates using a PDELight-HTS

cAMP Phosphodiesterase Kit (LT07-600, Lonza Inc., Rockland, ME).


9

Statistics

Data are expressed as mean ± s.d.. Statistical significance was determined by 1-way ANOVA

with a Fisher least significant difference test for comparison of multiple groups and 2-tailed

Student t test for comparison between two groups. Statistical analyses were performed using

GraphPad Prism 6 for Mac OS X (GraphPad Software Inc., San Diego, CA). A P value less than

0.05 was considered statistically significant.


10

RESULTS

DPP-4 inhibition improves left ventricular function in mice with hypertrophic heart failure

through GLP-1R independent mechanisms

In our first experiments, we set out to determine whether the cardiac effects of DPP-4 inhibition

are mediated through GLP-1R dependent or GLP-1R independent actions. Left ventricular

hypertrophy (LVH) is a major determinant of impaired contractile function in Type 2 diabetes

(reviewed in (31)), occurring in up to one third of cases (32). Because mouse models of diabetes

often do not develop LVH (33), we elected to examine the GLP-1R independent effects of DPP-

4 inhibition in mice subjected to transverse aortic constriction (TAC), a model of hypertrophic

heart failure (34). We treated wildtype and GLP-1R-/-

mice with the DPP-4 inhibitor, linagliptin,

which at a dose of 0.083g/kg resulted in a 77.5% reduction in plasma DPP-4 activity (plasma

DPP-4 activity (AU), control (n=5) 640±399, linagliptin (n=6) 144±52, p<0.05). Eight weeks

after TAC surgery, heart weight:tibial length and left ventricular (LV) mass were increased

equivalently in wildtype and GLP-1R-/-

mice (Supplemental Tables 2-5; Figure 1, A and B).

Linagliptin treatment had no effect on LV mass in either wildtype or GLP-1R-/-

mice (Figure 1, A

and B). Heart weight:tibial length was also unaltered with DPP-4 inhibition, although it was

marginally, but non-significantly, lower in linagliptin-treated TAC mice than TAC mice treated

with vehicle (Supplemental Tables 1 and 2). Despite little change in cardiac hypertrophy,

ejection fraction (Figure 1C), fractional shortening (Figure 1D), stroke volume (Figure 1E) and

cardiac output (Figure 1F) were all higher in linagliptin-fed wildtype and linagliptin-fed GLP-

1R-/-

TAC mice in comparison to TAC mice fed normal chow, with an equivalent increase in

each of these measures irrespective of the presence or absence of the GLP-1R (Figure 1C-F).


11

With respect to hemodynamic parameters, both end systolic pressure and peak systolic pressure

were increased in both wildtype and GLP-1R-/-

TAC mice treated with vehicle or linagliptin and,

like heart weight:tibial length, they were numerically but non-significantly lower with linagliptin

treatment (Supplemental Tables 6 and 7). As we have observed previously (35), the indicator of

diastolic function, Tau was unaltered in TAC mice (Supplemental Tables 6 and 7).

Paralleling the changes in LV mass, cardiomyocyte size, nuclear volume and ß-myosin heavy

chain mRNA levels were increased equivalently in wildtype and GLP-1R-/-

TAC mice, without

significant change with linagliptin treatment (Figure 2, A-D). Likewise, interstitial collagen

deposition was also increased in wildtype and GLP-1R-/-

TAC mice and was unchanged with

DPP-4 inhibition (Figure 2, E and F). In contrast, the preservation of cardiac contractile function

in wildtype and GLP-1R-/-

TAC mice treated with linagliptin was accompanied by an increase in

serine 16 phosphorylation of the Ca2+

handling protein phospholamban (PLN; phospho-PLN

(Ser16)) (Figure 2G), whereas total PLN and SERCA2a levels were unaltered (Figure 2, H and

I).

Linagliptin and the DPP-4 substrates substance P and CXCL12 improve recovery of ex

vivo cardiac contractility following ischemia reperfusion

The equivalent contractility enhancing effects of linagliptin in both TAC wildtype and TAC

GLP-1R-/-

mice suggested to us that at least some of the effects of DPP-4 inhibition are mediated

through GLP-1R independent actions, potentially non-GLP-1 substrates of DPP-4. To

investigate this possibility further we turned to an ex vivo isolated perfused heart system and we

subjected mouse hearts to 20 minutes no-flow ischemia followed by 40 minutes reperfusion. We


12

first studied the hearts of wildtype mice fed normal chow or linagliptin in chow. Baseline LVDP

did not differ between the hearts of chow-fed mice and mice treated with linagliptin (Figure 3A).

However, there was an approximate doubling in LVDP with linagliptin after no-flow ischemia

(Figure 3, A and B). Likewise, peak maximum and minimum dP/dt were also increased with

linagliptin after ischemia-reperfusion (Figure 3, C and D). Heart rate did not differ between the

groups either at baseline or following ischemia reperfusion (Figure 3E).

Next, we questioned whether the improvement in post-ischemic recovery with DPP-4 inhibition

could be mimicked by any of the physiological peptide substrates of DPP-4 and we perfused the

hearts of normal chow-fed wildtype mice with one of several different peptides i.e. GLP-1, GLP-

2, GIP, substance P or CXCL12 (36). Forty minutes after 20 minutes no-flow ischemia, LVDP

was significantly increased in substance P perfused hearts and CXCL12 perfused hearts, whereas

GLP-1, GLP-2 and GIP had no effect (Figure 4, A and B). Peak maximum and minimum dP/dt

and heart rate were marginally increased at baseline in GLP-1 perfused hearts, although only

peak minimum dP/dt achieved statistical significance (Figure 4, C and D). Maximum dP/dt,

minimum dP/dt and heart rate did not differ significantly between the various experimental

conditions after no-flow ischemia (Figure 4, C-E).

The DPP-4 substrates substance P and CXCL12 fail to improve post-ischemic recovery in

the hearts of aged, obese diabetic mice and paradoxically worsen basal contractility

Because young mice and aged, diabetic high fat diet-fed mice have recently been reported to

exhibit discordant responses to DPP-4 knockout or inhibition (37), we next set out to determine

whether the contractile effects of either substance P or CXCL12 would be different in the hearts


13

of aged, diabetic, high fat diet-fed (DM-HFD) mice (mean body weight 44.4±5.6g , mean blood

glucose 17.5±5.0mmol/L). Plasma DPP-4 activity was increased in DM-HFD mice (plasma

DPP-4 activity (AU) 1102±278 (n=5, p<0.01 vs. control)). Baseline LVDP and peak maximum

and minimum dP/dt did not differ between DM-HFD mice and age-matched non-diabetic normal

chow-fed mice (control) (Figure 5, A-C). However, unlike the hearts of the young adult mice

earlier studied, perfusion of DM-HFD hearts with either substance P or CXCL12 diminished

baseline LVDP and maximum and minimum dP/dt (Figure 5, A-C). Heart rate tended to be

lower in DM-HFD mouse hearts and was significantly lower than age-matched control hearts

after perfusion with either substance P or CXCL12 (Figure 5D). After no-flow ischemia, LVDP

(Figure 5A) and the percentage recovery of LVDP (Figure 5E) were significantly lower in DM-

HFD hearts than age-matched controls. Neither CXCL12 nor substance P improved post-

ischemic recovery in DM-HFD hearts (Figure 5E).

Both the DPP-4 inhibitor linagliptin and the DPP-4 substrate CXCL12 cause

phosphorylation of the regulator of cardiac Ca2+ cycling, PLN

Next, we set out to determine whether DPP-4 inhibition and the DPP-4 substrates, substance P

and CXCL12 activated similar signaling pathways in the hearts of non-diabetic mice subjected to

no-flow ischemia and whether these pathways are altered in DM-HFD hearts. Because we had

observed an increase in PLN (Ser16) phosphorylation in the hearts of TAC mice treated with

linagliptin, we focused our studies on Ca2+

regulatory protein changes. Like in TAC mice,

linagliptin also increased PLN (Ser16) phosphorylation in isolated perfused hearts (Figure 6A).

Interestingly, hearts perfused with CXCL12 also exhibited increased PLN (Ser16)

phosphorylation, whereas hearts perfused with substance P did not (Figure 6A). Total PLN and


14

SERCA2a levels were unaffected by any of the conditions (Figure 6, B and C). In contrast,

hearts of DM-HFD mice had markedly diminished levels of phospho-PLN (Ser16), with no

improvement with either CXCL12 or substance P (Figure 6D). We queried whether this

diminution in phospho-PLN (Ser16) could be compensated for by an increase in PLN threonine

17 phosphorylation (phospho-PLN (Thr17)), but similarly found a reduction in phospho-PLN

(Thr17) in DM-HFD hearts (Supplemental Figure 1). As in our earlier experiments in the hearts

of younger, non-diabetic mice, total PLN and SERCA2a levels were unaltered in any of the

experimental groups (Figure 6, E and F). Likewise, transcript levels of the substance P receptor

(NK1 receptor) or the principal receptor for CXCL12 (CXCR4) were unaltered in DM-HFD

hearts (NK1 receptor:RPL13a mRNA (AU) control (age 8-13 weeks, n=4) 1.1±0.4, DM-HFD

(age approximately 8 months, n=4) 1.1±0.2; CXCR4:RPL13a mRNA (AU) control 1.0±0.1, DM-

HFD 1.0±0.1).

PI3Kγγγγ inhibition negates the deleterious effects of CXCL12 on contractile function in aged,

obese diabetic mice

In our final series of experiments, we aimed to discern the mechanism(s) by which a non-GLP-1

DPP-4 substrate may have different effects in the hearts of young adult mice and aged, obese

diabetic mice. For these experiments, we focused on the actions of CXCL12 because, unlike

substance P, CXCL12 mimicked the increase in PLN (Ser16) phosphorylation in the hearts of

young mice caused by linagliptin treatment. In isolated adult mouse ventricular myocytes,

recombinant CXCL12 increased PLN (Ser16) phosphorylation (Figure 7A) and directly

enhanced Ca2+

flux (Figure 7, B-F). In considering how CXCL12 may paradoxically impair

cardiac function in the hearts of DM-HFD mice we recognized the known role of


15

phosphodiesterases (PDEs) in limiting PLN phosphorylation (38) and we found PDE activity to

be significantly increased in the hearts of DM-HFD mice (log10 PDE activity (AU), control (n=7,

age 6-13 weeks) 2.3±0.5, DM-HFD (n=12) 2.7±0.3, p<0.05). We observed a general trend

towards an increase in PDE isoform transcript abundance in DM-HFD hearts, mRNA levels of

the PDE4A isoform being significantly increased (2-fold) (Supplemental Table 8). Moreover,

the increase in PDE activity in DM-HFD mouse hearts was accompanied by a marked

upregulation in protein levels of p110γ (Figure 8A), the catalytic subunit of the lipid kinase,

PI3Kγ which is known to regulate PDE activity in cardiomyocytes (39). Because PI3Kγ is

activated by G-protein coupled receptors (GPCRs) (including CXCR4 (40)) and because PI3Kγ

has also been linked to impaired cardiac contractile function (41), we hypothesized that the

deleterious effects of CXCL12 in DM-HFD mice were mediated through the actions of

upregulated PI3Kγ. Consistent with this hypothesis, when we perfused the hearts of DM-HFD

mice with the PI3Kγ inhibitor, IPI-549 concurrently with CXCL12, we found that PI3Kγ

inhibition negated the deleterious effects of CXCL12 on basal LVDP (Figure 8, B-E).


16

DISCUSSION

Despite the widespread adoption of DPP-4 inhibitors into the glucose-lowering armamentarium

for the treatment of Type 2 diabetes, several questions remain unanswered regarding their

cardiac effects and the peptide substrates they affect. In the present study, we observed that

DPP-4 inhibition with linagliptin preserved cardiac contractility in pressure-overloaded mouse

hearts even in the absence of the GLP-1R and it also improved contractile recovery of mouse

hearts ex vivo. We went on to discover that this latter effect of linagliptin could be mimicked by

the non-GLP-1 DPP-4 substrate, CXCL12 which enhances cardiomyocyte Ca2+

flux. However,

in the setting of aging, obesity and diabetes, CXCL12 paradoxically worsened cardiac function,

an effect that appeared to be mediated by the lipid kinase, PI3Kγ. Collectively, the findings

highlight the extent to which peptide substrates of DPP-4, other than GLP-1, can affect cardiac

function and they demonstrate how these effects are profoundly influenced by diabetic

comorbidity.

In our first studies, we treated pressure-overloaded wildtype and GLP-1R-/-

mice with the DPP-4

inhibitor linagliptin. We chose a pressure overload model because of the importance of LVH as

a predeterminant of heart failure in diabetes (31). The dosing regimen of linagliptin that we

selected (0.083g/kg) resulted in a 77.5% reduction in plasma DPP-4 activity, just marginally

lower than that observed with the 5mg dose of linagliptin in patients (80-90% (42)). Both

wildtype and GLP-1R-/-

mice exhibited an equivalent reduction in ejection fraction, fractional

shortening, stroke volume and cardiac output following pressure-overload. However, linagliptin-

fed mice demonstrated a notable preservation of systolic function. The preservation of systolic


17

function with linagliptin is similar to that previously reported with the DPP-4 inhibitor,

vildagliptin (43). However, whereas the cardioprotective effects of vildagliptin were attributed

to improved glucose tolerance and increased GLP-1 levels (43), linagliptin was equally

efficacious in both wildtype and GLP-1R-/-

mice. This led us to conclude that DPP-4 inhibition

has GLP-1 independent cardiac effects and we speculated that these effects are most likely

mediated by the actions of one or more of the other peptide substrates of DPP-4. To help us

discern the similarities between the cardiac effects of DPP-4 inhibition and the cardiac effects of

individual DPP-4 peptide substrates we chose an isolated perfused heart system. Such an

approach allowed us to study the direct cardiac effects of individual peptide substrates of DPP-4

independent of any actions on the central or autonomic system or on preload or afterload.

We examined the effects of five physiological substrates of DPP-4 on LVDP recovery, GLP-1,

GLP-2, GIP, substance P and CXCL12 (44) and we observed that either substance P or CXCL12

improved LVDP recovery, comparable to linagliptin, whereas the other peptides did not. In a

non-reductionist sense, it is not surprising that the effects of linagliptin on the recovery of

contractile function could be mimicked by more than one peptide substrate and, indeed,

substance P (21) and CXCL12 (45) have both been reported to improve contractile recovery

following ischemia reperfusion in other studies. GLP-1 has also been previously reported to

improve the recovery of cardiac contractile function (46), although we did not observe this in the

present study. It is noteworthy, however, that we selected the concentrations of the different

peptide substrates with which to perfuse mouse hearts based on previously reported experiments

(in the absence of data regarding bioequivalence) and thus a direct comparison between the

magnitude of the effect of different peptides should be avoided.


18

At this point, our cognizance of the absence of cardiovascular benefit in outcome trials of other

DPP-4 inhibitors reported to date led us to question whether the cardiac effects of either

substance P or CXCL12 would be affected by diabetic comorbidity. To explore this possibility,

we studied the effects of the peptides in the hearts of aged, obese diabetic mice. These mice had

elevated plasma DPP-4 activity and an impairment of LVDP recovery. The increase in plasma

DPP-4 activity is similar to that previously reported in patients with Type 2 diabetes (47). We

observed that substance P or CXCL12 paradoxically impaired basal ex vivo LVDP in diabetic

high fat diet-fed mice and we surmised that this observation was indicative of the persistent

biological activity of the peptides even in the setting of increased plasma DPP-4 activity. We

speculated that the antithetical effects of substance P and CXCL12 in the hearts of young non-

diabetic mice and aged, obese diabetic mice could provide insights into the relative importance

of the signaling pathways the peptides activate and we probed for changes in the proteins that

regulate cardiomyocyte Ca2+

cycling, the signal that regulates cardiac muscle contractility.

The affinity of SERCA2a for Ca2+

is regulated by PLN. In its unphosphorylated state, PLN

limits SERCA2a Ca2+

affinity restricting cardiac contractility, whereas when it is phosphorylated

PLN no longer restricts SERCA2a Ca2+

affinity resulting in positive inotropic and lusitropic

effects (48). PLN can be phosphorylated at two sites, Ser16 (which is mediated by protein

kinase A) and Thr17 (which is mediated by Ca2+

/calmodulin-dependent protein kinase II

(CaMKII)) (49). We found that PLN (Ser16) phosphorylation was increased in the hearts of

wildtype and GLP-1R-/-

TAC mice treated with linagliptin and in the hearts of linagliptin-fed

mice subjected to no-flow ischemia. CXCL12 mimicked this effect of DPP-4 inhibition in


19

increasing phospho-PLN (Ser16) levels but substance P did not. However, in the hearts of aged,

obese diabetic mice PLN (Ser16) phosphorylation levels were diminished and they were

unaltered by either CXCL12 or substance P. This decrease in PLN (Ser16) phosphorylation

coincided with an increase in PDE activity, which itself is regulated by the lipid kinase, PI3Kγ

(39).

PI3Kγ is a Class IB PI3K that, unlike Class 1A PI3Ks, is activated by GPCRs. PI3Kγ consists of

a catalytic p110γ subunit tightly associated to an accessory or adaptor subunit, p101 (50). Upon

GPCR activation, the Gßγ complex separates from the Gα subunit allowing interaction between

p110γ and the Gßγ complex and resulting in p110γ translocation to the membrane and activation

of its kinase activity. p110γ is expressed by several cardiac cell-types, including cardiomyocytes

(41; 51). PI3Kγ activity is increased in human failing hearts (52) and, in the present study, its

protein levels were increased in the hearts of aged, diabetic high fat diet-fed mice. Loss of p110γ

increases cardiomyocyte contractility (41) through cyclic adenosine monophosphate (cAMP)

dependent mechanisms (53) and its activation in response to ß-adrenergic receptor stimulation

predisposes to myocardial hypertrophy and cardiac fibrosis (51). We hypothesized that the

impairment in LVDP in the CXCL12 perfused hearts of diabetic high fat diet-fed mice was due

to PI3Kγ upregulation and we found that inhibition of PI3Kγ negated the deleterious effects of

CXCL12 on basal LVDP.

A number of limitations of the experiments herein described are worth emphasizing. Firstly, we

studied the effects of linagliptin in vivo in TAC mice and the effects of linagliptin and the

peptides ex vivo in hearts subjected to ischemia reperfusion injury, reflecting our evolving


20

understanding of pathobiological mechanisms during the course of our studies. Accordingly, it

should be appreciated that the pathological processes occurring in the two model systems can be

quite different. However, it is interesting that linagliptin treatment improved the contractility of

the hearts of the young non-diabetic mice in both settings. Likewise, linagliptin (as well as the

GLP-1R agonist, liraglutide) has been reported to improve recovery after myocardial ischemia in

mice in vivo (54). Secondly, although the hearts of linagliptin-treated mice had improved

contractile function that could be mimicked by certain DPP-4 substrates, other than GLP-1, this

does not itself demonstrate that these substrates are responsible for the effects of DPP-4

inhibition in vivo or ex vivo. Commercial antibodies do not typically distinguish between active

and inactive forms of CXCL12 and an increase in active CXCL12 either systemically or locally

within the hearts of linagliptin-treated mice has not been demonstrated. Moreover, even if the

cardiac effects of DPP-4 inhibition in mice are mediated through increased CXCL12 activity, the

actions of endogenously produced active CXCL12 may be different from those of the

recombinant peptide. Thirdly, DPP-4 inhibition does not raise the bioactivity of a single

substrate in isolation and the combined effects of multiple peptides may be quite different from

the effects of any one of them alone. Treatment with the DPP-4 inhibitor MK-0626 impaired

cardiac function in aged, diabetic high fat-diet fed mice subjected to TAC (37). However, a

definitive understanding of the cardiovascular effects specifically of linagliptin in patients with

Type 2 diabetes will be provided by close examination of the results of the CARdiovascular

Outcome Study of LINAgliptin versus glimepiride in patients with Type 2 diabetes

(CAROLINA) and CARdiovascular and renal Microvascular outcomE study with LINAgliptin in

patients with Type 2 diabetes (CARMELINA) clinical trials. Notwithstanding these limitations,

the present experiments do reveal important biological insights that may be helpful in the


21

development of new treatment approaches in the future. They also complement, without

contradicting, a recently proposed hypothesis that, in some settings, DPP-4 substrates (including

CXCL12) can have adverse cardiac effects (55).

In summary, DPP-4 inhibition has effects on cardiac function in mice that extend beyond those

mediated by the GLP-1R. Some of these effects can be mimicked by peptide substrates of DPP-

4, other than GLP-1, in particular CXCL12, which has opposing actions in the hearts of young

adult mice and in aged, diabetic high fat diet-fed mice. Whereas CXCL12 enhances

cardiomyocyte Ca2+

handling, it can also impair cardiac contractility in the setting of aging,

obesity and diabetes, the latter effect occurring through PI3Kγ-dependent mechanisms. The

cardiac effects of DPP-4 substrates depend upon the metabolic context in which they act.


22

ACKNOWLEDGEMENTS

We thank Youan Liu and Suzanne L. Advani for technical assistance.

FUNDING

S.N.B. was a supported by a Keenan Family Foundation KRESCENT Post-doctoral Fellowship

through the Kidney Foundation of Canada and a Heart and Stroke/Richard Lewar Center of

Excellence Fellowship Award and a Banting and Best Diabetes Centre Hugh Sellers Post-

doctoral Fellowship. K.T. was supported by a Research Internship Abroad from the Sao Paulo

Research Foundation (Fapesp 2016/04591-1). F.H.Z. was supported by a Queen Elizabeth II

Graduate Scholarship in Science and Technology and an Ontario Graduate Scholarship. T.A.A.

is supported by a King Abdullah Foreign Scholarship. M.J.H. is a recipient of a Scholarship

from the Research Training Centre of St. Michael’s Hospital and a Banting and Best Diabetes

Centre - Novo Nordisk Studentship. S.M. was supported by a Diabetes Canada Post-doctoral

Fellowship. A.O.G. was supported by the Heart and Stroke Foundation of Ontario (T-6281).

K.A.C. is a recipient of a Canadian Institutes of Health Research New Investigator Award. A.A.

is a recipient of a Diabetes Investigator Award from Diabetes Canada. These studies were

supported by a grant from Boehringer Ingelheim.

DUALITY OF INTEREST

K.A.C. and A.A. are named as inventors on a patent application by Boehringer Ingelheim for the

use of DPP-4 inhibition in the treatment of heart failure. K.A.C. reports speaker honoraria from

Amgen, AstraZeneca, Boehringer Ingelheim, Eli Lilly, Janssen and Merck; and has received


23

research grant support from Amgen, AstraZeneca, Boehringer Ingelheim, Servier, Merck and Eli

Lilly. A.A. has received research support from Boehringer Ingelheim and AstraZeneca.

AUTHOR CONTRIBUTIONS

S.N.B. designed and performed the experiments, analyzed the data and wrote the manuscript.

K.T., F.H.Z., T.A.A., V.G.Y., M.J.H., S.M. and D.L. performed the experiments and analyzed

the data. M.G.K. and B.B. performed the in vivo experiments. A.O.G. supervised the in vitro

experiments. K.A.C. designed the experiments and oversaw the analysis of in vivo assessment of

cardiac function. A.A. designed the experiments, supervised the study and wrote the manuscript.

GUARANTOR STATEMENT

A.A. is the guarantor of this work and, as such, had full access to all the data in the study and

takes responsibility for the integrity of the data and the accuracy of the data analysis.

PRIOR PRESENTATION

Parts of this work were presented at the 76th

and 77th

Scientific Sessions of the American

Diabetes Association, New Orleans, LA (10th

- 14th

June 2016) and San Diego, CA (9th

- 13th

June 2017).


24

REFERENCES

1. Bell DS: Heart failure: the frequent, forgotten, and often fatal complication of diabetes.

Diabetes care 2003;26:2433-2441

2. Zinman B, Wanner C, Lachin JM, Fitchett D, Bluhmki E, Hantel S, Mattheus M, Devins T,

Johansen OE, Woerle HJ, Broedl UC, Inzucchi SE, Investigators E-RO: Empagliflozin,

Cardiovascular Outcomes, and Mortality in Type 2 Diabetes. N Engl J Med 2015;373:2117-2128

3. Green JB, Bethel MA, Armstrong PW, Buse JB, Engel SS, Garg J, Josse R, Kaufman KD,

Koglin J, Korn S, Lachin JM, McGuire DK, Pencina MJ, Standl E, Stein PP, Suryawanshi S,

Van de Werf F, Peterson ED, Holman RR, Group TS: Effect of Sitagliptin on Cardiovascular

Outcomes in Type 2 Diabetes. N Engl J Med 2015;373:232-242

4. Home PD, Pocock SJ, Beck-Nielsen H, Gomis R, Hanefeld M, Jones NP, Komajda M,

McMurray JJ, Group RS: Rosiglitazone evaluated for cardiovascular outcomes--an interim

analysis. N Engl J Med 2007;357:28-38

5. Scirica BM, Bhatt DL, Braunwald E, Steg PG, Davidson J, Hirshberg B, Ohman P, Frederich

R, Wiviott SD, Hoffman EB, Cavender MA, Udell JA, Desai NR, Mosenzon O, McGuire DK,

Ray KK, Leiter LA, Raz I: Saxagliptin and cardiovascular outcomes in patients with type 2

diabetes mellitus. N Engl J Med 2013;369:1317-1326

6. White WB, Cannon CP, Heller SR, Nissen SE, Bergenstal RM, Bakris GL, Perez AT, Fleck

PR, Mehta CR, Kupfer S, Wilson C, Cushman WC, Zannad F, Investigators E: Alogliptin after

acute coronary syndrome in patients with type 2 diabetes. N Engl J Med 2013;369:1327-1335

7. Ussher JR, Drucker DJ: Cardiovascular actions of incretin-based therapies. Circulation

research 2014;114:1788-1803

8. Dehlin HM, Levick SP: Substance P in heart failure: the good and the bad. International

journal of cardiology 2014;170:270-277

9. Bromage DI, Davidson SM, Yellon DM: Stromal derived factor 1alpha: a chemokine that

delivers a two-pronged defence of the myocardium. Pharmacol Ther 2014;143:305-315

10. Aroor AR, Sowers JR, Jia G, DeMarco VG: Pleiotropic effects of the dipeptidylpeptidase-4

inhibitors on the cardiovascular system. Am J Physiol Heart Circ Physiol 2014;307:H477-492

11. Jelsing J, Vrang N, van Witteloostuijn SB, Mark M, Klein T: The DPP4 inhibitor linagliptin

delays the onset of diabetes and preserves beta-cell mass in non-obese diabetic mice. The Journal

of endocrinology 2012;214:381-387

12. Chaykovska L, von Websky K, Rahnenfuhrer J, Alter M, Heiden S, Fuchs H, Runge F, Klein

T, Hocher B: Effects of DPP-4 inhibitors on the heart in a rat model of uremic cardiomyopathy.

PloS one 2011;6:e27861

13. Scrocchi LA, Brown TJ, MaClusky N, Brubaker PL, Auerbach AB, Joyner AL, Drucker DJ:

Glucose intolerance but normal satiety in mice with a null mutation in the glucagon-like peptide

1 receptor gene. Nature medicine 1996;2:1254-1258

14. Martino TA, Tata N, Belsham DD, Chalmers J, Straume M, Lee P, Pribiag H, Khaper N, Liu

PP, Dawood F, Backx PH, Ralph MR, Sole MJ: Disturbed diurnal rhythm alters gene expression

and exacerbates cardiovascular disease with rescue by resynchronization. Hypertension

2007;49:1104-1113

15. Connelly KA, Kelly DJ, Zhang Y, Prior DL, Martin J, Cox AJ, Thai K, Feneley MP,

Tsoporis J, White KE, Krum H, Gilbert RE: Functional, structural and molecular aspects of

diastolic heart failure in the diabetic (mRen-2)27 rat. Cardiovascular research 2007;76:280-291


25

16. Batchu SN, Law E, Brocks DR, Falck JR, Seubert JM: Epoxyeicosatrienoic acid prevents

postischemic electrocardiogram abnormalities in an isolated heart model. J Mol Cell Cardiol

2009;46:67-74

17. Nagai K, Tsuchiya K, Ezaki T, Tsuchiya M, Ohgawara H: Effect of GLP-1 (glucagon-like

peptide 1:7-36 amide) on porcine pancreatic endocrine cell proliferation and insulin secretion.

Pancreas 2004;28:138-145

18. Vila Petroff MG, Egan JM, Wang X, Sollott SJ: Glucagon-like peptide-1 increases cAMP but

fails to augment contraction in adult rat cardiac myocytes. Circulation research 2001;89:445-452

19. de Heer J, Pedersen J, Orskov C, Holst JJ: The alpha cell expresses glucagon-like peptide-2

receptors and glucagon-like peptide-2 stimulates glucagon secretion from the rat pancreas.

Diabetologia 2007;50:2135-2142

20. Moens K, Heimberg H, Flamez D, Huypens P, Quartier E, Ling Z, Pipeleers D, Gremlich S,

Thorens B, Schuit F: Expression and functional activity of glucagon, glucagon-like peptide I, and

glucose-dependent insulinotropic peptide receptors in rat pancreatic islet cells. Diabetes

1996;45:257-261

21. Wang L, Wang DH: TRPV1 gene knockout impairs postischemic recovery in isolated

perfused heart in mice. Circulation 2005;112:3617-3623

22. Jang YH, Kim JH, Ban C, Ahn K, Cheong JH, Kim HH, Kim JS, Park YH, Kim J, Chun KJ,

Lee GH, Kim M, Kim C, Xu Z: Stromal cell derived factor-1 (SDF-1) targeting reperfusion

reduces myocardial infarction in isolated rat hearts. Cardiovasc Ther 2012;30:264-272

23. Evans CA, Liu T, Lescarbeau A, Nair SJ, Grenier L, Pradeilles JA, Glenadel Q, Tibbitts T,

Rowley AM, DiNitto JP, Brophy EE, O'Hearn EL, Ali JA, Winkler DG, Goldstein SI, O'Hearn

P, Martin CM, Hoyt JG, Soglia JR, Cheung C, Pink MM, Proctor JL, Palombella VJ, Tremblay

MR, Castro AC: Discovery of a Selective Phosphoinositide-3-Kinase (PI3K)-gamma Inhibitor

(IPI-549) as an Immuno-Oncology Clinical Candidate. ACS Med Chem Lett 2016;7:862-867

24. Kai H, Muraishi A, Sugiu Y, Nishi H, Seki Y, Kuwahara F, Kimura A, Kato H, Imaizumi T:

Expression of proto-oncogenes and gene mutation of sarcomeric proteins in patients with

hypertrophic cardiomyopathy. Circulation research 1998;83:594-601

25. Frustaci A, Kajstura J, Chimenti C, Jakoniuk I, Leri A, Maseri A, Nadal-Ginard B, Anversa

P: Myocardial cell death in human diabetes. Circulation research 2000;87:1123-1132

26. Gerdes AM, Liu Z, Zimmer HG: Changes in nuclear size of cardiac myocytes during the

development and progression of hypertrophy in rats. Cardioscience 1994;5:203-208

27. Mayer EJ, Huckle W, Johnson RG, Jr., McKenna E: Characterization and quantitation of

phospholamban and its phosphorylation state using antibodies. Biochemical and biophysical

research communications 2000;267:40-48

28. Asahi M, Otsu K, Nakayama H, Hikoso S, Takeda T, Gramolini AO, Trivieri MG, Oudit

GY, Morita T, Kusakari Y, Hirano S, Hongo K, Hirotani S, Yamaguchi O, Peterson A, Backx

PH, Kurihara S, Hori M, MacLennan DH: Cardiac-specific overexpression of sarcolipin inhibits

sarco(endo)plasmic reticulum Ca2+ ATPase (SERCA2a) activity and impairs cardiac function in

mice. Proceedings of the National Academy of Sciences of the United States of America

2004;101:9199-9204

29. Gramolini AO, Trivieri MG, Oudit GY, Kislinger T, Li W, Patel MM, Emili A, Kranias EG,

Backx PH, Maclennan DH: Cardiac-specific overexpression of sarcolipin in phospholamban null

mice impairs myocyte function that is restored by phosphorylation. Proceedings of the National

Academy of Sciences of the United States of America 2006;103:2446-2451


26

30. Ackers-Johnson M, Li PY, Holmes AP, O'Brien SM, Pavlovic D, Foo RS: A Simplified,

Langendorff-Free Method for Concomitant Isolation of Viable Cardiac Myocytes and

Nonmyocytes From the Adult Mouse Heart. Circulation research 2016;119:909-920

31. Nassif M, Kosiborod M: Effect of glucose-lowering therapies on heart failure. Nat Rev

Cardiol 2018;15:282-291

32. Struthers AD, Morris AD: Screening for and treating left-ventricular abnormalities in

diabetes mellitus: a new way of reducing cardiac deaths. Lancet 2002;359:1430-1432

33. Cox EJ, Marsh SA: A systematic review of fetal genes as biomarkers of cardiac hypertrophy

in rodent models of diabetes. PloS one 2014;9:e92903

34. Houser SR, Margulies KB, Murphy AM, Spinale FG, Francis GS, Prabhu SD, Rockman HA,

Kass DA, Molkentin JD, Sussman MA, Koch WJ, American Heart Association Council on Basic

Cardiovascular Sciences CoCC, Council on Functional G, Translational B: Animal models of

heart failure: a scientific statement from the American Heart Association. Circulation research

2012;111:131-150

35. Bugyei-Twum A, Ford C, Civitarese R, Seegobin J, Advani SL, Desjardins JF, Kabir G,

Zhang Y, Mitchell M, Switzer J, Thai K, Shen V, Abadeh A, Singh KK, Billia F, Advani AA,

Gilbert RE, Connelly KA: Sirtuin 1 Activation Attenuates Cardiac Fibrosis in a Rodent Pressure

Overload Model by Modifying Smad2/3 Transactivation. Cardiovascular research 2018; Epub

ahead of print May 25

36. Drucker DJ: Dipeptidyl peptidase-4 inhibition and the treatment of type 2 diabetes:

preclinical biology and mechanisms of action. Diabetes care 2007;30:1335-1343

37. Mulvihill EE, Varin EM, Ussher JR, Campbell JE, Bang KW, Abdullah T, Baggio LL,

Drucker DJ: Inhibition of Dipeptidyl Peptidase-4 Impairs Ventricular Function and Promotes

Cardiac Fibrosis in High Fat-Fed Diabetic Mice. Diabetes 2016;65:742-754

38. Rapundalo ST, Solaro RJ, Kranias EG: Inotropic responses to isoproterenol and

phosphodiesterase inhibitors in intact guinea pig hearts: comparison of cyclic AMP levels and

phosphorylation of sarcoplasmic reticulum and myofibrillar proteins. Circulation research

1989;64:104-111

39. Ghigo A, Perino A, Mehel H, Zahradnikova A, Jr., Morello F, Leroy J, Nikolaev VO,

Damilano F, Cimino J, De Luca E, Richter W, Westenbroek R, Catterall WA, Zhang J, Yan C,

Conti M, Gomez AM, Vandecasteele G, Hirsch E, Fischmeister R: Phosphoinositide 3-kinase

gamma protects against catecholamine-induced ventricular arrhythmia through protein kinase A-

mediated regulation of distinct phosphodiesterases. Circulation 2012;126:2073-2083

40. Xie Y, Abel PW, Kirui JK, Deng C, Sharma P, Wolff DW, Toews ML, Tu Y: Identification

of upregulated phosphoinositide 3-kinase gamma as a target to suppress breast cancer cell

migration and invasion. Biochem Pharmacol 2013;85:1454-1462

41. Crackower MA, Oudit GY, Kozieradzki I, Sarao R, Sun H, Sasaki T, Hirsch E, Suzuki A,

Shioi T, Irie-Sasaki J, Sah R, Cheng HY, Rybin VO, Lembo G, Fratta L, Oliveira-dos-Santos AJ,

Benovic JL, Kahn CR, Izumo S, Steinberg SF, Wymann MP, Backx PH, Penninger JM:

Regulation of myocardial contractility and cell size by distinct PI3K-PTEN signaling pathways.

Cell 2002;110:737-749

42. Heise T, Graefe-Mody EU, Huttner S, Ring A, Trommeshauser D, Dugi KA:

Pharmacokinetics, pharmacodynamics and tolerability of multiple oral doses of linagliptin, a

dipeptidyl peptidase-4 inhibitor in male type 2 diabetes patients. Diabetes Obes Metab

2009;11:786-794


27

43. Takahashi A, Asakura M, Ito S, Min KD, Shindo K, Yan Y, Liao Y, Yamazaki S, Sanada S,

Asano Y, Ishibashi-Ueda H, Takashima S, Minamino T, Asanuma H, Mochizuki N, Kitakaze M:

Dipeptidyl-peptidase IV inhibition improves pathophysiology of heart failure and increases

survival rate in pressure-overloaded mice. Am J Physiol Heart Circ Physiol 2013;304:H1361-

1369

44. Mulvihill EE, Drucker DJ: Pharmacology, physiology, and mechanisms of action of

dipeptidyl peptidase-4 inhibitors. Endocr Rev 2014;35:992-1019

45. Huang C, Gu H, Zhang W, Manukyan MC, Shou W, Wang M: SDF-1/CXCR4 mediates

acute protection of cardiac function through myocardial STAT3 signaling following global

ischemia/reperfusion injury. Am J Physiol Heart Circ Physiol 2011;301:H1496-1505

46. Ban K, Noyan-Ashraf MH, Hoefer J, Bolz SS, Drucker DJ, Husain M: Cardioprotective and

vasodilatory actions of glucagon-like peptide 1 receptor are mediated through both glucagon-like

peptide 1 receptor-dependent and -independent pathways. Circulation 2008;117:2340-2350

47. Fadini GP, Albiero M, Menegazzo L, de Kreutzenberg SV, Avogaro A: The increased

dipeptidyl peptidase-4 activity is not counteracted by optimized glucose control in type 2

diabetes, but is lower in metformin-treated patients. Diabetes Obes Metab 2012;14:518-522

48. Marks AR: Calcium cycling proteins and heart failure: mechanisms and therapeutics. The

Journal of clinical investigation 2013;123:46-52

49. Mattiazzi A, Kranias EG: The role of CaMKII regulation of phospholamban activity in heart

disease. Front Pharmacol 2014;5:5

50. Oudit GY, Sun H, Kerfant BG, Crackower MA, Penninger JM, Backx PH: The role of

phosphoinositide-3 kinase and PTEN in cardiovascular physiology and disease. J Mol Cell

Cardiol 2004;37:449-471

51. Oudit GY, Crackower MA, Eriksson U, Sarao R, Kozieradzki I, Sasaki T, Irie-Sasaki J,

Gidrewicz D, Rybin VO, Wada T, Steinberg SF, Backx PH, Penninger JM: Phosphoinositide 3-

kinase gamma-deficient mice are protected from isoproterenol-induced heart failure. Circulation

2003;108:2147-2152

52. Perrino C, Schroder JN, Lima B, Villamizar N, Nienaber JJ, Milano CA, Naga Prasad SV:

Dynamic regulation of phosphoinositide 3-kinase-gamma activity and beta-adrenergic receptor

trafficking in end-stage human heart failure. Circulation 2007;116:2571-2579

53. Oudit GY, Kassiri Z: Role of PI3 kinase gamma in excitation-contraction coupling and heart

disease. Cardiovasc Hematol Disord Drug Targets 2007;7:295-304

54. Wang X, Ding Z, Yang F, Dai Y, Chen P, Theus S, Singh S, Budhiraja M, Mehta JL:

Modulation of myocardial injury and collagen deposition following ischaemia-reperfusion by

linagliptin and liraglutide, and both together. Clin Sci (Lond) 2016;130:1353-1362

55. Packer M: Do dipeptidyl peptidase-4 inhibitors cause heart failure events by promoting

adrenergically-mediated cardiotoxicity? Clues from laboratory models and clinical trials.

Circulation research 2018;122:928-932


28

FIGURE LEGENDS

Figure 1. The DPP-4 inhibitor linagliptin preserves cardiac contractility in pressure-overloaded

wildtype and GLP-1R knockout (GLP-1R-/-

) mice. Echocardiographic parameters in wildtype

and GLP-1R-/-

mice eight weeks after sham surgery or transverse aortic constriction (TAC) and

treated with normal chow or linaglipitin (0.083g/kg) in chow for eight weeks. Wildtype sham +

vehicle, n=15; wildtype sham + linagliptin, n=16; wildtype TAC + vehicle, n=15; wildtype TAC

+ linagliptin, n=13; GLP-1R-/-

sham + vehicle, n=12; GLP-1R-/-

sham + linagliptin, n=12; GLP-

1R-/-

TAC + vehicle, n=17; GLP-1R-/-

TAC + linagliptin, n=11. (A) Representative M-mode

echocardiographs. (B) Left ventricular mass. (C) Ejection fraction. (D) Fractional shortening.

(E) Stroke volume. (F) Cardiac output. Values are mean ± s.d.. *P < 0.05, **P < 0.01, ***P <

0.001 by 1-way ANOVA followed by Fisher least significant difference post hoc test.

Figure 2. Treatment with the DPP-4 inhibitor linagliptin increases phospholamban (PLN)

phosphorylation in the hearts of wildtype and GLP-1R knockout (GLP-1R-/-

) mice. Structural

changes and molecular changes in the hearts of wildtype and GLP-1R-/-

mice eight weeks after

sham surgery or transverse aortic constriction (TAC) and treated with normal chow or

linaglipitin (0.083g/kg) in chow for eight weeks. (A) Representative hematoxylin and eosin-

stained heart sections. Original magnification x400. Scale bar = 50µm. (B and C)

Cardiomyocyte cross sectional area (B) and nuclear volume (C). Wildtype sham + vehicle,

n=14; wildtype sham + linagliptin, n=16; wildtype TAC + vehicle, n=15; wildtype TAC +

linagliptin, n=12; GLP-1R-/-


sham + linagliptin, n=8; GLP-1R-/-


TAC + linagliptin, n=9. (D) ß-myosin heavy chain mRNA


29

levels. Wildtype sham + vehicle, n=15; wildtype sham + linagliptin, n=14: wildtype TAC +

vehicle, n=14; wildtype TAC + linagliptin, n=12; GLP-1R-/-




TAC + linagliptin, n=11.

(E) Representative picosirius red-stained heart sections. Original magnification x400. Scale bar

= 50µm. (F) Proportional picosirius red staining. Wildtype sham + vehicle, n=14; wildtype

sham + linagliptin, n=16; wildtype TAC + vehicle, n=13; wildtype TAC + linagliptin, n=12;

GLP-1R-/-



TAC + vehicle,

n=12; GLP-1R-/-

TAC + linagliptin, n=8. (G) Immunoblotting for PLN phosphorylation on

serine residue 16 (phospho-PLN (Ser16)) (n=4/group). (H) Immunoblotting for total PLN

(n=4/group). (I) Immunoblotting for SERCA2a (n=4/group). AU = arbitrary units. Values are

mean ± s.d.. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 by 1-way ANOVA followed

by Fisher least significant difference post hoc test.

Figure 3. The DPP-4 inhibitor linagliptin enhances ex vivo contractile recovery after transient

ischemia. Mice were fed linagliptin (0.083g/kg) in chow for one week, hearts were perfused

with Krebs-Henseleit buffer (KHB) and were subjected to 20 minutes no-flow ischemia followed

by 40 minutes reperfusion. Control, n=8; linagliptin, n=9. (A) Left ventricular developed

pressure (LVDP) at baseline and 40 minutes after ischemia reperfusion (R40). (B) Percentage

LVDP recovery. (C) Peak maximum dP/dt. (D) Peak minimum dP/dt. (E) Heart rate. Values

are mean ± s.d.. *P < 0.05, **P < 0.01 by 2-tailed Student t test.

Figure 4. Substance P and CXCL12 enhance ex vivo cardiac function in young adult wildtype

mice. Hearts were perfused with Krebs-Henseleit buffer (KHB) alone (control, n=5) or with


30

KHB supplemented with GLP-1 (10nM, n=4), GLP-2 (10nM, n=4), GIP (10nM, n=4), substance

P (1µM, n=4) or CXCL12 (25nM, n=4) throughout the procedure and were subjected to 20

minutes no-flow ischemia followed by 40 minutes reperfusion (R40). (A) Left ventricular

developed pressure (LVDP) at baseline and 40 minutes after ischemia reperfusion (R40). (B)

Percentage LVDP recovery. (C) Peak maximum dP/dt. (D) Peak minimum dP/dt. (E) Heart

rate. Values are mean ± s.d.. *P < 0.05, **P < 0.01, ***P < 0.001 by 1-way ANOVA followed

by Fisher least significant difference post hoc test.

Figure 5. Substance P and CXCL12 impair baseline ex vivo cardiac contractility in aged,

diabetic high fat diet-fed (DM-HFD) mice. Hearts were perfused with Krebs-Henseleit buffer

(KHB) alone or with KHB supplemented with substance P (1µM) or CXCL12 (25nM)

throughout the procedure and were subjected to 20 minutes no-flow ischemia followed by 40

minutes reperfusion (R40). Age-matched control, n=4; DM-HFD, n=5; DM-HFD + substance P,

n=5; DM-HFD + CXCL12, n=4. Of the DM-HFD hearts, one of five perfused with KHB failed

to recover after no-flow ischemia, three of five perfused with substance P failed to recover (so no

error bar shown) and one of four perfused with CXCL12 failed to recover. (A) Left ventricular

developed pressure (LVDP) at baseline and 40 minutes after ischemia reperfusion (R40). (B)

Peak maximum dP/dt. (C) Peak minimum dP/dt. (D) Heart rate. (E) Percentage LVDP

recovery. Values are mean ± s.d.. *P < 0.05, **P < 0.01 by 1-way ANOVA followed by Fisher

least significant difference post hoc test for baseline values and 2-tailed Student t test for R40

values.


31

Figure 6. CXCL12 increases phospholamban (PLN) phosphorylation in the hearts of young

adult mice but not in the hearts of aged, diabetic high fat diet-fed mice. Immunoblotting for

Ca2+

-handling proteins in the hearts of young adult mice treated with linagliptin or perfused with

substance P or CXCL12 (A-C) or the hearts of aged, diabetic high fat diet-fed mice (DM-HFD)

perfused with substance P or CXCL12 (D-F) and subjected to no-flow ischemia (n=3/group).

(A) Immunoblotting for phosphorylation of PLN on serine residue 16 (phospho-PLN (Ser16)).

(B) Immunoblotting for total PLN. (C) Immunoblotting for SERCA2a. (D) Immunoblotting for

phospho-PLN (Ser16) in DM-HFD hearts. (E) Immunoblotting for total PLN in DM-HFD

hearts. (F) Immunoblotting for SERCA2a in DM-HFD hearts. AU = arbitrary units. Values are

mean ± s.d.. **P < 0.01 by 1-way ANOVA followed by Fisher least significant difference post

hoc test.

Figure 7. CXCL12 increases Ca2+

flux in cardiomyocytes isolated from young adult mice. (A)

Immunoblotting for phosphorylation of phospholamban (PLN) on serine residue 16 (phospho-

PLN (Ser16)) in cardiomyocytes under control conditions or following exposure to 25nM

CXCL12 for 10 minutes (n=5/condition). (B) Rate of 50% Ca2+

uptake. (C) Overall Ca2+

uptake

rate. (D) Ca2+

release amplitude. (E) Rate of 50% Ca2+

release. (F) Overall Ca2+

release rate.

Control, n=12 individual cells; CXCL12, n=17 individual cells. AU = arbitrary units. Values

are mean ± s.d.. *P < 0.05, **P < 0.01 by 2-tailed Student t test.

Figure 8. Phosphoinositide-3 kinase γ (PI3Kγ) inhibition negates the deleterious effects of

CXCL12 on cardiac contractility in aged, diabetic high fat diet-fed mice (DM-HFD). (A)

Immunoblotting heart homogenates of control or DM-HFD mice for the p110γ subunit of PI3Kγ


32

(n=3/group). (B-E) Effect of PI3Kγ inhibition with IPI-549 (30nM) on the reduction in baseline

left ventricular developed pressure (LVDP) in DM-HFD mouse hearts perfused with CXCL12

(n=4/group). (B) LVDP. (C) Peak maximum dP/dt. (D) Peak minimum dP/dt. (E) Heart rate.

AU = arbitrary units. Values are mean ± s.d.. *P < 0.05, **P < 0.01 by 2-tailed Student t test

(A) and 1-way ANOVA followed by Fisher least significant difference post hoc test (B, C, D, E).


Figure 1. The DPP-4 inhibitor linagliptin preserves cardiac contractility in pressure-overloaded wildtype and GLP-1R knockout (GLP-1R-/-) mice. Echocardiographic parameters in wildtype and GLP-1R-/- mice eight

weeks after sham surgery or transverse aortic constriction (TAC) and treated with normal chow or linaglipitin (0.083g/kg) in chow for eight weeks. Wildtype sham + vehicle, n=15; wildtype sham +

linagliptin, n=16; wildtype TAC + vehicle, n=15; wildtype TAC + linagliptin, n=13; GLP-1R-/- sham + vehicle, n=12; GLP-1R-/- sham + linagliptin, n=12; GLP-1R-/- TAC + vehicle, n=17; GLP-1R-/- TAC +

linagliptin, n=11. (A) Representative M-mode echocardiographs. (B) Left ventricular mass. (C) Ejection fraction. (D) Fractional shortening. (E) Stroke volume. (F) Cardiac output. Values are mean +/- s.d.. *P

< 0.05, **P < 0.01, ***P < 0.001 by 1-way ANOVA followed by Fisher least significant difference post hoc test.

215x187mm (300 x 300 DPI)


Figure 2. Treatment with the DPP-4 inhibitor linagliptin increases phospholamban (PLN) phosphorylation in the hearts of wildtype and GLP-1R knockout (GLP-1R-/-) mice. Structural changes and molecular changes in the hearts of wildtype and GLP-1R-/- mice eight weeks after sham surgery or transverse aortic constriction (TAC) and treated with normal chow or linaglipitin (0.083g/kg) in chow for eight weeks. (A) Representative hematoxylin and eosin-stained heart sections. Original magnification x400. Scale bar = 50µm. (B and C) Cardiomyocyte cross sectional area (B) and nuclear volume (C). Wildtype sham + vehicle, n=14; wildtype sham + linagliptin, n=16; wildtype TAC + vehicle, n=15; wildtype TAC + linagliptin, n=12; GLP-1R-/- sham

+ vehicle, n=11; GLP-1R-/- sham + linagliptin, n=8; GLP-1R-/- TAC + vehicle, n=13; GLP-1R-/- TAC +

linagliptin, n=9. (D) ß-myosin heavy chain mRNA levels. Wildtype sham + vehicle, n=15; wildtype sham + linagliptin, n=14: wildtype TAC + vehicle, n=14; wildtype TAC + linagliptin, n=12; GLP-1R-/- sham + vehicle, n=11; GLP-1R-/- sham + linagliptin, n=12; GLP-1R-/- TAC + vehicle, n=15; GLP-1R-/- TAC +

linagliptin, n=11. (E) Representative picosirius red-stained heart sections. Original magnification x400. Scale bar = 50µm. (F) Proportional picosirius red staining. Wildtype sham + vehicle, n=14; wildtype sham + linagliptin, n=16; wildtype TAC + vehicle, n=13; wildtype TAC + linagliptin, n=12; GLP-1R-/- sham

+ vehicle, n=9; GLP-1R-/- sham + linagliptin, n=8; GLP-1R-/- TAC + vehicle, n=12; GLP-1R-/- TAC + linagliptin, n=8. (G) Immunoblotting for PLN phosphorylation on serine residue 16 (phospho-PLN (Ser16))

(n=4/group). (H) Immunoblotting for total PLN (n=4/group). (I) Immunoblotting for SERCA2a (n=4/group). AU = arbitrary units. Values are mean +/- s.d.. *P < 0.05, **P < 0.01, ***P < 0.001,

****P < 0.0001 by 1-way ANOVA followed by Fisher least significant difference post hoc test.

215x166mm (300 x 300 DPI)


Figure 3. The DPP-4 inhibitor linagliptin enhances ex vivo contractile recovery after transient ischemia. Mice were fed linagliptin (0.083g/kg) in chow for one week, hearts were perfused with Krebs-

Henseleit buffer (KHB) and were subjected to 20 minutes no-flow ischemia followed by 40 minutes reperfusion. Control, n=8; linagliptin, n=9. (A) Left ventricular developed pressure (LVDP) at baseline and

40 minutes after ischemia reperfusion (R40). (B) Percentage LVDP recovery. (C) Peak maximum dP/dt. (D) Peak minimum dP/dt. (E) Heart rate. Values are mean +/- s.d.. *P < 0.05, **P < 0.01 by 2-

tailed Student t test.

133x121mm (300 x 300 DPI)


Figure 4. Substance P and CXCL12 enhance ex vivo cardiac function in young adult wildtype mice. Hearts were perfused with Krebs-Henseleit buffer (KHB) alone (control, n=5) or with KHB supplemented with GLP-1

(10nM, n=4), GLP-2 (10nM, n=4), GIP (10nM, n=4), substance P (1µM, n=4) or CXCL12 (25nM, n=4) throughout the procedure and were subjected to 20 minutes no-flow ischemia followed by 40 minutes reperfusion (R40). (A) Left ventricular developed pressure (LVDP) at baseline and 40 minutes after

ischemia reperfusion (R40). (B) Percentage LVDP recovery. (C) Peak maximum dP/dt. (D) Peak minimum dP/dt. (E) Heart rate. Values are mean +/- s.d.. *P < 0.05, **P < 0.01, ***P < 0.001 by 1-way ANOVA

followed by Fisher least significant difference post hoc test.

138x90mm (300 x 300 DPI)


Figure 5. Substance P and CXCL12 impair baseline ex vivo cardiac contractility in aged, diabetic high fat diet-fed (DM-HFD) mice. Hearts were perfused with Krebs-Henseleit buffer (KHB) alone or with KHB

supplemented with substance P (1µM) or CXCL12 (25nM) throughout the procedure and were subjected to 20 minutes no-flow ischemia followed by 40 minutes reperfusion (R40). Age-matched control, n=4; DM-

HFD, n=5; DM-HFD + substance P, n=5; DM-HFD + CXCL12, n=4. Of the DM-HFD hearts, one of five perfused with KHB failed to recover after no-flow ischemia, three of five perfused with substance P failed to recover (so no error bar shown) and one of four perfused with CXCL12 failed to recover. (A) Left ventricular

developed pressure (LVDP) at baseline and 40 minutes after ischemia reperfusion (R40). (B) Peak

maximum dP/dt. (C) Peak minimum dP/dt. (D) Heart rate. (E) Percentage LVDP recovery. Values are mean +/- s.d.. *P < 0.05, **P < 0.01 by 1-way ANOVA followed by Fisher least significant difference post

hoc test for baseline values and 2-tailed Student t test for R40 values.

194x172mm (300 x 300 DPI)


Figure 6. CXCL12 increases phospholamban (PLN) phosphorylation in the hearts of young adult mice but not in the hearts of aged, diabetic high fat diet-fed mice. Immunoblotting for Ca2+-handling proteins in the hearts of young adult mice treated with linagliptin or perfused with substance P or CXCL12 (A-C) or the hearts of aged, diabetic high fat diet-fed mice (DM-HFD) perfused with substance P or CXCL12 (D-F) and subjected to no-flow ischemia (n=3/group). (A) Immunoblotting for phosphorylation of PLN on serine

residue 16 (phospho-PLN (Ser16)). (B) Immunoblotting for total PLN. (C) Immunoblotting for SERCA2a. (D) Immunoblotting for phospho-PLN (Ser16) in DM-HFD hearts. (E) Immunoblotting for total PLN in DM-HFD hearts. (F) Immunoblotting for SERCA2a in DM-HFD hearts. AU = arbitrary units. Values

are mean +/- s.d.. **P < 0.01 by 1-way ANOVA followed by Fisher least significant difference post hoc test.

180x173mm (300 x 300 DPI)


Figure 7. CXCL12 increases Ca2+ flux in cardiomyocytes isolated from young adult mice. (A) Immunoblotting for phosphorylation of phospholamban (PLN) on serine residue 16 (phospho-PLN (Ser16)) in

cardiomyocytes under control conditions or following exposure to 25nM CXCL12 for 10 minutes (n=5/condition). (B) Rate of 50% Ca2+ uptake. (C) Overall Ca2+ uptake rate. (D) Ca2+ release

amplitude. (E) Rate of 50% Ca2+ release. (F) Overall Ca2+ release rate. Control, n=12 individual cells; CXCL12, n=17 individual cells. AU = arbitrary units. Values are mean +/- s.d.. *P < 0.05, **P < 0.01 by

2-tailed Student t test.

143x114mm (300 x 300 DPI)


Figure 8. Phosphoinositide-3 kinase γ (PI3Kγ) inhibition negates the deleterious effects of CXCL12 on cardiac contractility in aged, diabetic high fat diet-fed mice (DM-HFD). (A) Immunoblotting heart

homogenates of control or DM-HFD mice for the p110γ subunit of PI3Kγ (n=3/group). (B-E) Effect of PI3Kγ

inhibition with IPI-549 (30nM) on the reduction in baseline left ventricular developed pressure (LVDP) in DM-HFD mouse hearts perfused with CXCL12 (n=4/group). (B) LVDP. (C) Peak maximum dP/dt. (D) Peak

minimum dP/dt. (E) Heart rate. AU = arbitrary units. Values are mean +/- s.d.. *P < 0.05, **P < 0.01 by 2-tailed Student t test (A) and 1-way ANOVA followed by Fisher least significant difference post hoc test (B,

C, D, E).

147x158mm (300 x 300 DPI)


Supplemental Table 1. Primer sequences.

Forward primer sequence (5'→3') Reverse primer sequence (5'→3')

ß-MHC CTACAGGCCTGGGCTTACCT TCTCCTTCTCAGACTTCCGC

NK1 TGGCTCTACAGGCTCGTCA TTCATGTTCGATTTTGCGGTCA

CXCR4 TGCAGCAGGTAGCAGTGAAA TGTATATACTCACACTGATCGGTTC

PDE2A GGTGGCCTCGAAATCTGTGCTGG GCATGCGCTGATAGTCCTTCCG

PDE3A AGAGATTCCGGGGTGGAAGA TGATGCTGGTTCCTGACTGG

PDE4A CTTCTGCGAGACCTGCTCCA GAGTTCCCGGTTCAGCATCC

PDE4B AATGTGGCTGGGTACTCACA AAGGTGTCAGATGAGATTTTAAACG

PDE4D ACCGCCAGTGGACGGACCGGA CATGCCACGCTCCCGCTCTCGG

PDE5A AAATCAATTCAGTTTTGAAGATCC TGTTGAATAGGCCAGGGTTT

RPL13a GCTCTCAAGGTTGTTCGGCTGA AGATCTGCTTCTTCTTCCGATA

ß-MHC = ß-myosin heavy chain; PDE = phosphodiesterase


2

Supplemental Table 2. Metabolic parameters of sham-operated wildtype (WT) mice or WT

mice undergoing transverse aortic constriction (TAC) surgery and treated with vehicle or

linagliptin for eight weeks.

WT sham +

vehicle

WT sham +

linagliptin

WT TAC +

vehicle

WT TAC +

linagliptin

n 15 16 15 13

Body weight (g) 29±3 30±2 29±3 31±3

Heart weight (mg) 164±25 153±21 205±62ab 182±37

Heart weight:body weight

(mg/g)

5.6±0.8 5.1±0.9 7.3±2.8bc 5.8±1.1d

Heart weight:tibial length

(mg/mm)

8.8±1.6 7.6±1.7 10.9±3.6ce 9.9±2.6f

Lung weight (mg) 186±32 195±36 215±67 219±57

HbA1c (%) 4.6±0.3 4.7±0.2 4.8±0.3 4.6±0.2

HbA1c (mmol/mol) 26.9±3.3 28.1±2.4 28.7±3.0 26.4±2.4

Values are mean ± s.d.. aP < 0.01 vs. WT sham + vehicle, bP < 0.001 vs. WT sham + linagliptin,

cP < 0.05 vs. WT sham + vehicle, dP < 0.05 vs. WT TAC + vehicle, eP < 0.01 vs. WT sham +

linagliptin, fP < 0.05 vs. WT sham + linagliptin, by 1-way ANOVA followed by Fisher least

significant difference post hoc test.


3

Supplemental Table 3. Metabolic parameters of sham-operated GLP-1R knockout (GLP-

1R-/-) or GLP-1R-/- mice undergoing transverse aortic constriction (TAC) surgery and treated

with vehicle or linagliptin for eight weeks.

GLP-1R-/- sham

+ vehicle

GLP-1R-/- sham

+ linagliptin

GLP-1R-/- TAC

+ vehicle

GLP-1R-/- TAC

+ linagliptin

n 12 12 17 11

Body weight (g) 28±2 28±2 28±3 27±3

Heart weight (mg) 159±20 161±30 204±53ab 195±38cd

Heart weight:body

weight (mg/g)

5.7±0.7 5.9±0.9 7.4±2.0ad 7.4±1.9cd

Heart weight:tibial length

(mg/mm)

8.4±1.2 8.3±0.2 11.0±2.7ab 10.5±2.2cd

Lung weight (mg) 204±46 165±35 181±32 225±77be

HbA1c (%) 4.8±0.3 4.6±0.4 4.8±0.4 4.7±0.3

HbA1c (mmol/mol) 29.2±3.7 27.1±4.1 28.7±3.8 28.4±1.7

Values are mean ± s.d.. aP < 0.01 vs. GLP-1R-/- sham + vehicle, bP < 0.01 vs. GLP-1R-/- sham +

linagliptin, cP < 0.05 vs. GLP-1R-/- sham + vehicle, dP < 0.05 vs. GLP-1R-/- sham + linagliptin,

eP < 0.05 vs. GLP-1R-/- TAC + vehicle, by 1-way ANOVA followed by Fisher least significant

difference post hoc test.


4

Supplemental Table 4. Heart rate and chamber dimensions determined by M-mode

echocardiography in sham-operated wildtype (WT) mice or WT mice undergoing transverse

aortic constriction (TAC) surgery and treated with vehicle or linagliptin for eight weeks.

WT sham +

vehicle

WT sham +

linagliptin

WT TAC +

vehicle

WT TAC +

linagliptin

Heart rate (bpm) 385±52 393±58 355±64 425±67a

LVDs (mm) 3.0±0.4 2.7±0.6 3.4±1.1b 2.7±0.6c

LVDd (mm) 4.2±0.4 4.0±0.4 4.3±0.9 4.0±0.4

LVESV (µl) 37±12 29±14 42±19d 29±16e

LVEDV (µl) 80±18 71±16 90±55 72±15

LVAWT (mm) 4.2±0.4 3.9±0.4 4.3±0.9 3.9±0.4

LVPWT (mm) 0.8±0.2 0.8±0.2 1.0±0.2df 0.9±0.2g

bpm = beats per minute, LVDs = left ventricular internal diameter at systole, LVDd = left

ventricular internal diameter at diastole, LVESV = left ventricular end systolic volume, LVEDV

= left ventricular end diastolic volume, LVAWT = left ventricular anterior wall thickness, LVPWT

= left ventricular posterior wall thickness

Values are mean ± s.d.. aP < 0.01 vs. WT TAC + vehicle, bP < 0.01 vs. WT sham + linagliptin, cP

< 0.01 vs. WT TAC + vehicle, dP < 0.05 vs. WT sham + linagliptin, eP < 0.05 vs. WT TAC +

vehicle, fP < 0.01 vs. WT sham + vehicle, gP < 0.05 vs. WT sham + vehicle, by 1-way ANOVA

followed by Fisher least significant difference post hoc test.


5

Supplemental Table 5. Heart rate and chamber dimensions determined by M-mode

echocardiography in sham-operated GLP-1R knockout (GLP-1R-/-) mice or GLP-1R-/- mice

undergoing transverse aortic constriction (TAC) surgery and treated with vehicle or

linagliptin for eight weeks.

GLP-1R-/- sham

+ vehicle

GLP-1R-/- sham

+ linagliptin

GLP-1R-/- TAC

+ vehicle

GLP-1R-/- TAC

+ linagliptin

Heart rate (bpm) 424±73 390±57 377±78 404±72

LVDs (mm) 2.8±0.6 3.2±0.7 3.6±0.7a 3.0±0.6b

LVDd (mm) 4.0±0.4 4.3±0.4 4.4±0.6 4.2±0.3

LVESV (µl) 31±17 44±19 57±29 47±32

LVEDV (µl) 73±17 85±19 91±28 90±33

LVAWT (mm) 4.0±0.4 4.2±0.5 4.4±0.6 4.2±0.7

LVPWT (mm) 0.8±0.2 0.8±0.1 0.9±0.1 1.0±0.2cd

bpm = beats per minute, LVDs = left ventricular internal diameter at systole, LVDd = left

ventricular internal diameter at diastole, LVESV = left ventricular end systolic volume, LVEDV

= left ventricular end diastolic volume, LVAWT = left ventricular anterior wall thickness, LVPWT

left ventricular posterior wall thickness

Values are mean ± s.d.. aP < 0.01 vs. GLP-1R-/- sham + vehicle, bP < 0.05 vs. GLP-1R-/- TAC +

vehicle, cP < 0.05 vs. GLP-1R-/- sham + vehicle, dP < 0.05 vs. GLP-1R-/- sham + linagliptin, by 1-

way ANOVA followed by Fisher least significant difference post hoc test.


6

Supplemental Table 6. Invasive hemodynamic parameters in sham-operated wildtype (WT)

mice or WT mice undergoing transverse aortic constriction (TAC) surgery and treated with

vehicle or linagliptin for eight weeks.

WT sham +

vehicle

WT sham +

linagliptin

WT TAC +

vehicle

WT TAC +

linagliptin

Ejection fraction (%) 57±14 61±8 41±28a 61±23b

Pmax (mmHg) 93±11 102±11 153±26cd 152±30cd

ESP (mmHg) 89±13 97±12 144±24c 135±32c

EDP (mmHg) 13±7 13±8 14±5 17±10

dP/dt max (mmHg/sec) 5281±1744 6965±2230 8022±2350e 7570±2436a

dP/dt min (mmHg/sec) -4712±1712 -6249±1605 -7496±2141f -6622±1365a

Tau (ms) 12.5±3.3 10.8±3.8 9.5±2.3 10.1±2.3

Pmax = maximum pressure (peak systolic pressure), ESP = end systolic pressure, EDP = end

diastolic pressure

Values are mean ± s.d.. aP < 0.05 vs. WT sham + vehicle, bP < 0.05 vs. WT TAC + vehicle, cP <

0.0001 vs. WT sham + vehicle, dP < 0.0001 vs. WT sham + linagliptin, eP < 0.01 vs. WT sham +

vehicle, fP < 0.001 vs. WT sham + vehicle, by 1-way ANOVA followed by Fisher least significant

difference post hoc test.


7

Supplemental Table 7. Invasive hemodynamic parameters in sham-operated GLP-1R

knockout (GLP-1R-/-) mice or GLP-1R-/- mice undergoing transverse aortic constriction

(TAC) surgery and treated with vehicle or linagliptin for eight weeks.

GLP-1R-/- sham

+ vehicle

GLP-1R-/- sham

+ linagliptin

GLP-1R-/- TAC

+ vehicle

GLP-1R-/- TAC

+ linagliptin

Ejection fraction (%) 59±11 48±12 44±13a 50±16

Pmax (mmHg) 100±11 104±10 143±31bc 128±19de

ESP (mmHg) 96±11 102±10 137±31bf 119±20a

EDP (mmHg) 10±4 16±8 16±7 14±9

dP/dt max (mmHg/sec) 6716±1893 6334±831 6461±2340 5735±1648

dP/dt min (mmHg/sec) -5874±1200 -5633±968 -6157±1957 -5932±1701

Tau (ms) 10.2±2.2 11.6±3.0 11.4±3.2 10.9±2.0

Pmax = maximum pressure (peak systolic pressure), ESP = end systolic pressure, EDP = end

diastolic pressure

Values are mean ± s.d.. aP < 0.05 vs. GLP-1R-/- sham + vehicle, bP < 0.0001 vs. GLP-1R-/- sham

+ vehicle, cP < 0.0001 vs. GLP-1R-/- sham + linagliptin, dP < 0.01 vs. GLP-1R-/- sham + vehicle,

eP < 0.05 vs. GLP-1R-/- sham + linagliptin, fP < 0.001 vs. GLP-1R-/- sham + linagliptin, by 1-way

ANOVA followed by Fisher least significant difference post hoc test.


8

Supplemental Table 8. Phosphodiesterase (PDE) isoform mRNA levels in the hearts of non-

obese, non-diabetic mice aged 6-13 weeks (young) or aged approximately 8 months (age-

matched) or diabetic high fat-diet (DM-HFD) mice aged approximately 8 months.

Young hearts Age-matched hearts DM-HFD hearts

PDE2A 1.00±0.04 1.08±0.14 1.46±1.11

PDE3A 1.00±0.05 1.06±0.10 1.65±1.10

PDE4A 1.09±0.50 1.00±0.38 2.05±0.64ab

PDE4B 1.01±0.16 0.98±0.36 1.19±1.03

PDE4D 1.00±0.10 0.95±0.19 1.71±1.13

PDE5A 1.00±0.05 0.88±0.06 1.21±0.85

Values are normalized to RPL13a and are expressed as mean ± s.d.. n=4/group. aP < 0.05 vs.

young hearts, bP < 0.05 vs. age-matched hearts by 1-way ANOVA followed by Fisher least

significant difference post hoc test.


9

Supplemental Figure 1. Phospholamban (PLN) phosphorylation on threonine residue 17 (phospho-PLN (Thr17)) is reduced in the hearts of diabetic high fat diet-fed (DM-HFD) mice and unaffected by substance P or CXCL12. Immunoblotting for phospho-PLN (Thr17) in DM-HFD hearts (n=3/group). AU = arbitrary units. Values are mean ± s.d.. *P < 0.05 by 1-way ANOVA followed by Fisher least significant difference post hoc test.


Documents

Page 1 of 49 Diabetes...Aug 21, 2018 · substrates ex vivo, Krebs-Henseleit buffer (KHB) was supplemented with GLP-1 (10nM ... Images were acquired using a Rolera MGi plus EMCCD