THE INTERPLAY BETWEEN PRO-DEATH AND PRO-SURVIVAL

SIGNALING PATHWAYS CONVERGING AT MITOCHONDRIA IN

MYOCARDIAL ISCHEMIA/REPERFUSION: APOPTOSIS MEETS AUTOPHAGY

Von der Fakultät für Mathematik, Informatik und Naturwissenschaften der Rheinisch-Westfälischen Technischen Hochschule Aachen zur Erlangung des akademischen Grades

einer Doktorin der Naturwissenschaften genehmigte Dissertation

vorgelegt von

Diplom-Biologin

Anne Hamacher

aus Aachen

Berichter: Universitätsprofessor Dr. Fritz Kreuzaler Privatdozent Dr. Christoph Peterhänsel

Tag der mündlichen Prüfung: 15. September 2006

Diese Dissertation ist auf den Internetseiten der Hochschulbibliothek online verfügbar.

FOR MY DAUGHTER ZOË The research described in this thesis was carried out at the Department of Molecular and Experimental Medicine of The Scripps Research Institute, California, USA under the auspices of the RWTH Aachen, Germany.

ABBREVIATIONS

.

i

Abbreviations

ADP adenosine diphosphate

AIF apoptosis-inducing factor

ANT adenine nucleotide translocator

Apaf-1 apoptotic protease activating factor 1

ATP adenosine triphosphate

AV(s) autophagic vacuole(s)

Baf A1 bafilomycin A1

Bax Bcl-2 associated X protein

Bcl-2 B-cell leukemia/lymphoma 2

BD binding domain

BH3 Bcl-2 homology domain 3

Bid Bcl-2 interacting domain

Bnip3 Bcl-2/adenovirus E1B 19 kDa interacting protein

CFP cyan fluorescent protein

Ca2+

calcium

CsA cyclosporin A

DCF 2',7'-dichlorofluorescein

CM-DCFH2-DA chloromethyl dichlorodihydrofluorescein diacetate

DNA deoxyribonucleic acid

∆Ψm mitochondrial transmembrane potential

EDTA ethylene diamine tetraacetic acid

ETC electron transport chain

FADD Fas-associated death domain

FADH2 1,5-dihydroflavin adenine dinucleotide

4D four-dimensional (X/Y/Z/time)

FRET fluorescence resonance energy transfer

GFP green fluorescent protein

GDP guanosine diphosphate

GTP guanosine triphosphate

H+ proton

IAPs inhibitor of apoptosis proteins

I/R ischemia/reperfusion

kDa kilo Dalton

KH Krebs-Henseleit

Lamp2 lysosomal-associated membrane protein 2

LC3 microtubule-associated protein light chain 3

LSCM laser scanning confocal microscopy

LTR LysoTracker Red

MAPK mitogen-activated protein kinase

MCS multiple cloning site

µM micro-molar (µmol/L)

mM mill-molar (mmol/L)

MPT(P) mitochondrial permeability transition (pore)

ABBREVIATIONS

.

ii

mRNA messenger ribonucleic acid

mTOR mammalian target of rapamycin

N.A. numerical apertur

NADH nicotinamide adenine dinucleotide

ORF open reading frame

PBS phosphate buffered saline

PCD programmed cell death

PE phosphatidylethanolamine

PI3-K phosphatidylinositol 3-kinase

PI3-P phosphatidylinositol 3-phosphate

RFP red fluorescent protein

RIRR ROS-induced ROS release

RNA ribonucleic acid

RNAi RNA interference

ROS reactive oxygen species

SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis

S/ER sarco/endoplasmic reticulum

SERCA sarco/endoplasmic reticulum calcium ATPase

sI/R simulated ischemia/reperfusion

tBid truncated Bid

TM transmembrane

TMRM tetramethylrhodamine methyl ester

TNF-α tumor necrosis factor-α

TRADD TNF-α-associated death domain

3D 3-dimensional (X/Y/Z)

3-MA 3-methyladenine

v-ATPase vacuolar ATPase

VDAC voltage dependent anion channel

YFP yellow fluorescent protein

TABLE OF CONTENTS

.

iii

Table of contents

Abbreviations……………………………………………………………………………..i

Table of contents…………………………………………………………………………iii

I Introduction ……...………………………………...……...………………………….1

I-1 Heart disease ....................................................................................................... 3

I-2 The heart and its working units........................................................................... 4

I-3 Myocardial cell death during I/R injury.............................................................. 5

I-3.1 Pathways and executers of apoptosis (PCD type I) ........................................ 6

I-3.1.1 Receptor-mediated death pathway.......................................................... 7

I-3.1.2 Mitochondrial death pathway ................................................................. 7

I-3.2 Death signaling at the mitochondria ............................................................... 9

I-3.2.1 Mitochondrial permeability transition.................................................. 10

I-3.2.2 Mitochondrial ROS generation............................................................. 10

I-3.2.3 Mitochondrial calcium handling........................................................... 11

I-3.3 Regulation of mitochondrial integrity by Bcl-2 family members................. 12

I-3.3.1 Anti-apoptotic Bcl-2 family members ................................................... 13

I-3.3.2 Pro-apoptotic Bcl-2 family members .................................................... 14

I-4 Autophagy – at the interface between death and survival ................................ 15

I-4.1 Molecular mechanism of autophagy............................................................. 15

I-4.1.1 Autophagosome formation .................................................................... 16

I-4.1.2 Autophagosome maturation .................................................................. 19

I-4.1.3 Degradation within the autophagolysosome ........................................ 19

I-4.2 Regulation of autophagy............................................................................... 20

I-4.2.1 Negative regulation of autophagy......................................................... 20

I-4.2.2 Positive regulation of autophagy .......................................................... 20

I-4.3 Cross-talk of autophagy and apoptosis: Bcl-2 family members ................... 21

I-4.3.1 Anti-apoptotic Bcl-2 family members ................................................... 22

I-4.3.2 Pro-apoptotic Bcl-2 family members .................................................... 22

I-4.4 Autophagy in the heart.................................................................................. 23

I-5 Thesis objectives............................................................................................... 24

I-5.1 Cell culture model of I/R injury to the heart................................................. 24

I-5.2 Elucidation of the regulation of Beclin1-mediated autophagy ..................... 24

I-5.3 Role of Beclin1-mediated autophagy in myocardial I/R injury.................... 25

I-5.4 Connection between mitochondrial dysfunction and autophagy.................. 25

I Materials and Methods ……...……………………..……...……………………….27

II-1 Materials ........................................................................................................... 29

II-1.1 Antibodies ................................................................................................. 29

II-1.1.1 Primary antibodies............................................................................ 29

II-1.1.2 Horseradish peroxidase-conjugated secondary antibodies.............. 30

II-2 Methods............................................................................................................. 30

TABLE OF CONTENTS

.

iv

II-2.1 Cloning and plasmid construction ............................................................ 30

II-2.1.1 pmCherry-C1 .................................................................................... 31

II-2.1.2 mCherry-Bax..................................................................................... 31

II-2.1.3 Mito-ECFP........................................................................................ 31

II-2.1.4 YFP-Bid-CFP.................................................................................... 32

II-2.1.5 mCherry-Atg5 ................................................................................... 32

II-2.2 Site-directed mutagenesis ......................................................................... 32

II-2.2.1 mCherry-BaxT182A

.............................................................................. 33

II-2.2.2 YFP-Bid∆∆∆∆casp8-CFP ........................................................................ 33

II-2.2.3 mCherry- Atg5K130R

........................................................................... 33

II-2.3 RNA interference ...................................................................................... 33

II-2.3.1 Bnip3 ................................................................................................. 34

II-2.3.2 Beclin1 .............................................................................................. 34

II-2.4 Cell culture................................................................................................ 34

II-2.5 Transfections............................................................................................. 35

II-2.5.1 Effectene transfection protocol ......................................................... 35

II-2.5.2 Lipofectamine transfection protocol ................................................. 35

II-2.6 High and low nutrient condition ............................................................... 36

II-2.7 Simulated ischemia/reperfusion (sI/R) ..................................................... 36

II-2.8 Fluorescence microscopy.......................................................................... 36

II-2.8.1 Widefield fluorescence microscopy................................................... 36

II-2.8.2 Laser Scanning Confocal Microscopy (LSCM) ................................ 37

II-2.9 Detection of ROS and ∆Ψm ...................................................................... 37

II-2.10 Assessment of mitochondrial morphology ............................................... 38

II-2.11 Quantification of cellular injury................................................................ 38

II-2.11.1 Redistribution of (mCherry-)GFP-Bax ............................................. 38

II-2.11.2 Plasma membrane integrity .............................................................. 38

II-2.12 Quantification of cellular autophagosome content ................................... 39

II-2.13 Determination of LC3-II degradation ....................................................... 39

II-2.14 Activity of the lysosomal compartment.................................................... 39

II-2.15 Ca2+

imaging ............................................................................................. 40

II-2.16 Image processing and analysis.................................................................. 40

II-2.17 Immunoblotting......................................................................................... 41

II-2.18 Statistics .................................................................................................... 41

III-VI Results……...………………………………...……………………..…….…….43

III Pro-apoptotic Bcl-2 family members and mitochondrial dysfunction during

ischemia/reperfusion injury……………………………………………………………43

III-1 Simulated I/R in HL-1 cardiac myocytes induces mitochondrial dysfunction .

.. and PCD............................................................................................................ 45

III-2 Mitochondrial dysfunction and fragmentation.................................................. 46

III-2.1 sI/R-induced mitochondrial fragmentation is mediated by Drp1 ............. 48

III-3 Bax activation in sI/R........................................................................................ 48

III-3.1 Bax translocation and clustering............................................................... 50

TABLE OF CONTENTS

.

v

III-3.2 Bax translocation and clustering, mitochondrial fragmentation, and ∆Ψm...

................................................................................................................... 51

III-4 GFP-Bax clustering as a parameter of sI/R-induced injury.............................. 53

III-5 Drp1-mediated mitochondrial fragmentation protects against sI/R.................. 57

III-6 Bid activation in sI/R monitored by a GFP biosensor ...................................... 57

III-6.1 sI/R-induced cardiac myocyte Bid cleavage is mediated by caspase 8 .... 58

III-7 Spatio-temporally resolved interplay of Bid and Bax at the mitochondria ...... 61

IV Bcl-2 regulation of sarco/endoplasmic reticulum calcium stores mediates the

autophagic response to nutrient deprivation in HL-1 cardiac myocytes……………65

IV-1 Inhibiting lysosomal activity to quantify autophagic flux ................................ 65

IV-2 Quantifying autophagy in HL-1 cardiac myocytes........................................... 67

IV-2.1 Pharmacologic activation of autophagy.................................................... 67

IV-2.2 Autophagic response to nutrient deprivation ............................................ 69

IV-2.3 Molecular perturbation of the autophagic pathway .................................. 70

IV-2.4 Beclin1 control of the autophagic response to nutrient deprivation is ..

………dependent on a functional Bcl-2/-xL binding domain............................... 72

IV-3 Bcl-2 suppression of the autophagic response to nutrient deprivation is ..

………dependent on its subcellular localization .................................................. 73

IV-4 Bcl-2 overexpression inhibits autophagy due to depletion of sequestered S/ER

… Ca2+

stores ......................................................................................................... 75

IV-5 Positive regulation of autophagy by S/ER Ca2+ .............................................. 76

V Enhancing macroautophagy protects against ischemia/reperfusion injury in

HL-1 cardiac myocytes......…………………………………………………………81

V-1 Cellular autophagosomal content is increased during the early phase of sI/R

…………injury................................................................................................................. 81

V-2 Changes in autophagic activity during ischemia an reperfusion ...................... 83

V-2.1 Flux of LC3-II degradation during sI/R.................................................... 83

V-2.2 Lysosomal activity during sI/R................................................................. 85

V-3 Unraveling the role of autophagy in sI/R injury ............................................... 86

V-3.1 Pharmacological perturbation of autophagy induction influences sI/R

………injury…..…………………………………………………………………86

V-3.2 Beclin1 protects from sI/R-activated injury and increases autophagic flux .

……………………………………………………………………………90

V-3.3 Beclin1 protection against sI/R injury requires a functional Bcl-2 binding

………domain.…………………………………………………………………...92

V-3.4 Inhibition of Atg5 aggravates injury and counteracts protection conferred

………by Beclin1 ................................................................................................. 94

VI Mitophagy as part of the autophagic survival response during

ischemia/reperfusion injury in HL-1 cardiac myocytes…………………………….100

TABLE OF CONTENTS

.

vi

VI-1 Fragmented mitochondria are targets of autophagy during reperfusion ............... 100

VI-2 Bnip3 overexpression as a surrogate for sI/R-induced mitochondrial

dysfunction............................................................................................................. 102

VI-3 Bnip3 induces autophagy in cardiac HL-1 cells.................................................... 104

VI-4 Bnip3 causes autophagy of mitochondrial fragments ........................................... 106

VI-5 Autophagy is a protective response against Bnip3-induced cell death ................. 107

VII Discussion……………..…………………………………………………………114

VII-1 Chapter I: HL-1 cell culture model of myocardial I/R injury allowing for the

spatio-temporal investigation of apoptosis-related signaling pathways ......................... 114

VII-1.1 Mitochondrial dysfunction is an early event in sI/R injury to HL-1 cardiac

myocytes ............................................................................................................. 115

VII-1.2 Pro-apoptotic Bax activity ...................................................................... 115

VII-1.3 Bid activation and translocation.............................................................. 116

VII-1.4 Bcl-2 and Bax activation: role of subcellular localization...................... 117

VII-1.5 sI/R-induced mitochondrial fragmentation ............................................. 117

VII-1.6 Conclusions............................................................................................. 119

VII-2 Chapter IV: Investigating autophagy in HL-1 cardiac myocytes .................. 120

VII-2.1 Determination of autophagic flux ........................................................... 120

VII-2.2 Regulation of Beclin1-mediated autophagy............................................ 121

VII-2.2.1 Endogenous Bcl-2 promotes Beclin1-mediated autophagy during

nutrient deprivation ........................................................................................ 121

VII-2.2.2 S/ER-localized Bcl-2 depletes S/ER Ca2+

-content, thereby inhibiting

autophagy........................................................................................................ 122

VII-2.3 Conclusions: Chapter IV......................................................................... 123

VII-3 Chapter V: Autophagy in sI/R ....................................................................... 123

VII-3.1 Autophagic flux during sI/R ................................................................... 123

VII-3.2 Enhancing autophagic flux protects against sI/R injury ......................... 125

VII-3.3 Protection, Bcl-2, and autophagy............................................................ 125

VII-3.4 Conclusions: Chapter V .......................................................................... 126

VII-4 Chapter VI: Nature of protection exerted by autophagy: role of mitophagy. 127

VII-4.1 Autophagic scavenging of mitochondria (mitophagy) during sI/R ........ 128

VII-4.2 Bnip3 and activation of the sI/R apoptotic pathway............................... 128

VII-4.2.1 Bnip3, mitochondrial fragmentation, and autophagy..................... 129

VII-4.2.2 Autophagy protects against Bnip3 apoptotic signaling .................. 129

VII-4.2.3 Signal for mitophagy?..................................................................... 129

VII-4.3 Conclusions............................................................................................. 130

VII-5 Perspectives: Significance in the heart ........................................................... 130

VIII Summary……………………………………………………………………….133

IX References……………………………………………………………………...137

X Appendix……………………………………………………………………….155

Chapter 1

Introduction

________________________________________________________________________

Adapted from: Hamacher-Brady A., Brady N.R., and R.A. Gottlieb. “The interplay between pro-

death and pro-survival signaling pathways in myocardial ischemia/reperfusion: apoptosis meets

autophagy.” Cardiovasc Drugs Ther.

INTRODUCTION

I

3

I-1 Heart disease

The heart is a muscular pump which is responsible for circulating blood throughout the

body, in order to deliver cells with nutrients and oxygen, the substrate permitting aerobic

metabolism, as well as to carry away their waste products. The human heart begins

beating at approximately 4-5 weeks following conception and continues, hopefully

uninterrupted, until death, beating around 3 billion times.

Despite its central importance, the working conditions of the average heart are

worsening. Approximately one third of all deaths in the Western industrialized world are

caused by the effects of acute or chronic limitations to coronary blood flow (Thom et al.,

2006). Many of these deaths are attributable to modifiable risk factors, such as obesity,

hypertension, and smoking (Ellsworth et al., 1999; Poulter, 2003), which are prevalent

and increasing throughout the world. Thus, in all likelihood heart disease will remain the

leading cause of death for generations to come.

A crucial event in the development of heart disease is the hardening and

narrowing of the blood-supplying arteries (atherosclerosis, coronary heart disease). Key

to the pathogenesis is the abundance of cholesterol (Huxley et al., 2002), a component of

cell membranes which serves to regulate membrane fluidity and permeability. High

levels of low-density-lipoprotein (LDL)-cholesterol lead to the gradual build-up of

plaques, which in severe conditions results in reduced blood supply and thus, insufficient

oxygenation of myocardial tissues. As a consequence, the heart loses its ability to

properly circulate blood throughout the body, the condition referred to as congestive

heart failure.

A myocardial infarction, or heart attack, occurs when a coronary artery supplying

oxygen-rich blood to a region of the heart is blocked (e.g. due to coronary obstruction,

surgical clamp, heart transplantation). The resulting condition of low oxygen and

nutrient supply is termed ischemia (from Greek: ‘ischo’, to hold back, and ‘haima’,

blood), and is accompanied by decreased intracellular availability of ATP, and low pH,

partly due to increased lactate concentrations. Following a bout of ischemia, reperfusion

(e.g. via vasodilator pharmaceuticals, angioplasty) must be achieved in order to prevent

the irreversible destruction of affected tissues. Paradoxically, reperfusion itself causes

INTRODUCTION

I

4

damage and subsequent cell death. This condition is referred to as ischemia/reperfusion

(I/R) injury.

Mitochondria, the ‘powerhouses’ of the cell, are key integrators and controllers of

the pathways mediating I/R injury. Depending on the magnitude of the insult,

mitochondria either promote cellular survival (Oldenburg et al., 2002) or transform into

lethal entities, executing cell death (Gustafsson and Gottlieb, 2003; Crow et al., 2004).

The mitochondrial response is in part controlled by the interplay between pro-life and

pro-death Bcl-2 family members which decides the prevalence of survival or death

signals. Understanding the events leading to and stemming from mitochondrial

dysfunction is crucial for the ultimate goal of treating heart disease and preventing I/R-

activated cell death.

I-2 The heart and its working units

The heart is divided into two upper chambers, the atria, and two lower chambers, the

ventricles. Contraction of the right ventricle pumps blood from the Vena cava inferior

and superior via the Aorta pulmonalis through the lungs. Simultaneous contraction of the

more powerful left ventricle pumps the oxygenated blood through the aorta into the body.

Pumping of the blood is accomplished via the rhythmic sequence of contraction (systole)

and relaxation (diastole). The blood supply of the body (~five liters in an adult) is

circulated once per minute. This astonishing pumping action is generated through highly

coordinated contraction of a mesh of billions of heart muscle cells, known as cardiac

myocytes or cardiomyocytes, which are interconnected via gap junctions (Severs, 2000).

Cardiac myocytes are a terminally differentiated cell type, i.e. they do not divide and thus

are of limited number. There is a recent debate whether cardiac myocytes are

regenerated within the heart (Anversa et al., 2006); however, any innate regenerative

capability can not be sufficient to recover from most pathologies.

Cardiac myocytes have a high energy expenditure and accordingly 30% of the

cardiac cellular volume is accounted for by mitochondria (Page et al., 1971), which are

responsible for almost all the supply of ATP. ATP is the free-energy carrier fuelling

most cellular energy-dependent operations; in the cardiac myocyte approximately 30% of

ATP is used to maintain calcium homeostasis and 60% is used to power contraction

INTRODUCTION

I

5

(Opie, 1998). Mitochondria generate ATP through a process termed oxidative

phosphorylation. Electrons originating from nutrients are carried to the electron transport

chain by NADH and FADH2 and then transferred along a series of carrier molecules in

the inner mitochondrial membrane, driving the extrusion of protons (H+) from the matrix

across the inner mitochondrial membrane into the mitochondrial intermembrane space to

form the protonmotive force (∆µH+). ∆µH

+ describes the electrochemical potential

difference for H+ across the inner mitochondrial membrane, which represents the net

electric potential difference (∆Ψm) and the difference in pH (∆pH). The free energy

contained within ∆µH+ can be used to drive H

+ back through the F1F0 ATPase into the

matrix whereby ADP is phosphorylated to generate ATP (Saraste, 1999b). Cardiac

myocytes must continually replenish their supply of ATP, which would be exhausted

within seconds in the absence of resynthesis: In a 70 kg individual, ATP turnover of the

human heart exceeds 6 kg per day, yet total ATP content in the heart amounts to about

3.5 grams (Ingwall, 2002).

I-3 Myocardial cell death during I/R injury

As discussed above, I/R injury is a major cause of cell death, leading to extensive loss of

myocardial tissue and consequently reduced myocardial function. It has been established

that cell death occurs via both necrosis and apoptosis (Kajstura et al., 1996), two distinct

modes of death. Necrosis (Greek for: death, causing to die) is a degenerative process in

which cellular integrity is lost and the release of cytosolic contents provokes an

inflammatory response (Searle et al., 1982). Ischemia induces necrosis in a certain

subset of cells, whereby the extent of necrotic cell loss is a function of the duration of the

ischemic insult. Necrotic cells are mainly found in the central zone of the infarct (infarct

= region of dead tissue).

In contrast, apoptosis (from Greek: ‘falling off’, figurative for the falling of

leaves; also termed programmed cell death (PCD) type I) is a highly-regulated,

genetically-determined mechanism that does not provoke an inflammatory response

(Saraste, 1999a). Moreover, apoptosis requires energy in form of ATP for its successful

completion. Apoptosis plays a role in pathophysiological conditions but is also essential

in normal tissue homeostasis, allowing the organ or tissue to rid itself of cells which are

INTRODUCTION

I

6

dysfunctional or no longer needed. Apoptotic cell death is characterized by cell

shrinkage, membrane blebbing, and nuclear condensation and degradation. The cell is

eventually broken into small membrane-enclosed pieces (apoptotic bodies), which in vivo

are removed by macrophages, or taken up by neighboring cells. This prevents the release

of cellular compounds and thus ensures that an inflammatory response is not provoked.

In I/R injury, apoptotic cell loss manifests itself during the reperfusion period due to the

slowly orchestrated execution of the apoptotic cell death program, and is more apparent

at the marginal zone of the infarct. In addition to its contribution to I/R injury, apoptosis

has been implicated in the pathogenesis of several cardiovascular diseases including

nonischemic dilated cardiomyopathy (Schoppet et al., 2005) and congestive heart failure

(Narula et al., 1996; Olivetti et al., 1997).

Recently, a second mode of programmed cell death (PCD type II), termed

autophagic cell death, has been discovered which is characterized morphologically by the

presence of numerous autophagic vacuoles (Bursch, 2001). Autophagy is a vital process

by which macromolecules and organelles are being delivered to lysosomal degradation

(see I.4). Uncontrolled or excessive autophagy is thought to cause cell death via the

extensive degradation of cytoplasmic constituents. Under these conditions

pharmacological or molecular inhibition of the components of the autophagic pathway

prevents cell death. Autophagic cell death has been implicated in heart failure (Knaapen

et al., 2001; Shimomura et al., 2001; Miyata et al., 2006) and myocardial hibernation

(Elsasser et al., 2004). However, the data used in the support of this hypothesis is

correlative or relies on the use of nonspecific inhibitors. To date there is no direct

evidence implicating autophagic cell death as a contributor to I/R injury.

I-3.1 Pathways and executers of apoptosis (PCD type I)

PCD presents a target for reducing the size of the infarct, and thus preserving myocardial

function following I/R injury. In the heart, apoptosis is mediated by two central

pathways, the receptor-mediated (extrinsic) and the mitochondrial (intrinsic) pathway

(Crow et al., 2004) both of which are depicted in Fig. 1. So-called caspases, a family of

cysteine aspartate proteases, are the main effectors of, and allow for crosstalk between,

both pathways (Thornberry and Lazebnik, 1998; Stennicke and Salvesen, 2000).

INTRODUCTION

I

7

Caspases are synthesized as inactive precursors and generally activated by proteolytic

cleavage of the procaspase form to the catalytically active heterotetramer (Shi, 2002).

I-3.1.1 Receptor-mediated death pathway

The receptor-mediated (extrinsic) pathway is initiated by the binding of a death ligand

(e.g. CD95 /Fas ligand, TNF-α) to its cognate cell surface death receptor (e.g. CD95/Fas,

TNF-α receptor) (Ashkenazi and Dixit, 1998; Schmitz et al., 2000). Consequently, death

adapter molecules such as FADD (Fas-associated death domain) and TRADD (TNF

receptor-accociated death domain) form homotrimers which are recruited to the

cytoplasmic tail of the death receptor through interactions between “death domains”

present in both proteins (Tartaglia and Goeddel, 1992; Chinnaiyan et al., 1995; Hsu et al.,

1995). Subsequently, procaspase 8 is recruited to the complex resulting in increased

proximity of the molecules which forces autocatalytic homooligomerization and

processing (Muzio et al., 1998). Once activated, caspase 8 initiates the apoptotic cascade

via processing of downstream effector caspases such as caspase 3 (Nicholson et al., 1995;

Tewari et al., 1995) and pro-apoptotic Bcl-2 family member Bid (Li et al., 1998), leading

to the death of the cell.

Recently, the receptor-mediated death pathway was linked to the progression of

heart disease: mice lacking functional Fas exhibited smaller infarcts following a model of

in vivo I/R injury (Lee et al., 2003), while increased levels of Fas ligand are present in

congestive heart failure (Schumann et al., 1997; Yamaguchi et al., 1999) and were

associated with I/R-induced apoptosis of cardiac myocytes (Kajstura et al., 1996).

Likewise, increased TNF-α production was reported to occur during myocardial I/R

injury and linked to mitochondrial damage (Lefer et al., 1990; Kimura et al., 2006).

I-3.1.2 Mitochondrial death pathway

Under pathophysiological conditions (e.g. enhanced oxidative stress and/or calcium

overload) mitochondria participate in the apoptotic pathway (Green and Reed, 1998;

Desagher and Martinou, 2000). Death signals transmitted to the mitochondria lead to the

release of pro-apoptotic proteins from the mitochondrial intermembrane space to the

cytosol, through pathways which are still subject to much debate and investigation. The

majority of studies focused on the release of cytochrome c, which normally functions as

INTRODUCTION

I

8

part of the mitochondrial electron transport chain. Two main models have been proposed

to describe the mechanism(s) of cytochrome c release to the cytosol (Bernardi et al.,

1999; Lim et al., 2002). The first model describes a non-specific mode of release in

which opening of the mitochondrial permeability transition pore (MPTP, I-3.2.1) leads to

the swelling of mitochondria due to the osmotic influx of water into the protein- and

metabolite-dense mitochondrial matrix. The highly convoluted inner mitochondrial

membrane is able to expand while the outer mitochondrial membrane ruptures, releasing

cytochrome c into the cytosol. The second model describes specific modes of release,

where Bcl-2 family proteins (I-3.3) either form pores directly via oligomerization,

regulate the pore size of pre-existing pores, or induce the formation of lipidic pores by

causing membrane instability.

In the cytosol, cytochrome c binds to Apaf1 (apoptotic protease activating factor

1) and, in the presence of dATP, procaspase 9 is recruited to the complex, now termed

the apoptosome, leading to the activation of procaspase 9 (Rodriguez and Lazebnik,

1999; Acehan et al., 2002). Activated caspase 9 can activate downstream effector

caspases, and thus determine the cell to death. Cytochrome c-dependent activation of

caspase 9 is supported by Smac/DIABLO which is likewise released from the

mitochondrial intermembrane space and removes the anti-apoptotic activity of IAPs

(inhibitor of apoptosis proteins) (Du et al., 2000; Verhagen et al., 2000). In addition,

mitochondria release endonuclease G and AIF (apoptosis-inducing factor) which

translocate to the nucleus and promote chromatin condensation and large-scale DNA

fragmentation (Sharpe et al., 2004).

The mitochondrial death pathway appears to play an important role in the

execution of apoptosis in cardiac myocytes (Gottlieb and Engler, 1999; Gustafsson and

Gottlieb, 2003; Crow et al., 2004). Caspase-dependent cytochrome c release has been

reported in isolated chick cardiac myocytes subjected to simulated I/R (Qin et al., 2004)

and several parameters of mitochondrial-mediated apoptosis were demonstrated during

myocardial I/R injury in vivo (Lundberg and Szweda, 2004) and in vitro (Chen et al.,

2001). Furthermore, preservation of mitochondrial integrity via inhibition of the MPTP

(Halestrap et al., 2004) or counterbalancing of pro-apoptotic Bcl-2 protein activity

(Brocheriou et al., 2000; Gustafsson et al., 2002) proved cardioprotective in I/R injury.

INTRODUCTION

I

9

Procaspase 8

Bid

tBid

CD95LCD95L

Receptor-mediated death pathway Mitochondrial death pathway

CD95CD95

FADDFADD

Caspase 8Procaspase 3

Caspase 3

Plasma membrane

Bax

Apaf-1

+ ATP

Apoptosome

Apoptotic substrates

EndoG

Smac/DIABLO

AIF

IAPs

Bcl-2/-xL

Procaspase 9

Cytochrome c

NucleusNucleus

Caspase 9

Mitochondrion

FIG. 1. Comprehensive schema of signaling pathways implicated in apoptosis (PCD type I) of cardiac myocytes. Depending on the stimuli apoptosis may be initiated extrinsically via the engagement of cell surface death receptors or intrinsically via the mitochondrial pathway. The receptor-mediated death pathway is initiated by binding of a death ligand (e.g. CD95L/FasL) to its cognate receptor (e.g. CD95/Fas) in the plasma membrane. The cytoplasmic tail of the death receptor then engages death adaptor molecules (e.g. FADD), resulting in the recruitment and activation of Procaspase 8. Caspase 8 activates downstream effector caspases such as caspase 3, resulting in the execution of apoptosis. Caspase 8 also activates Bid, thereby linking the two death pathways. The mitochondrial death pathway is regulated by the Bcl-2 family of proteins (see I.3.3). Cellular stresses are communicated to the mitochondria by pro-apoptotic Bcl-2 family members (e.g. Bid, Bax), leading to the release of pro-apoptotic molecules (e.g. cytochrome c, EndoG, AIF, Smac/DIABLO) from the mitochondrial intermembrane space into the cytosol where they initiate the apoptotic cascade. Anti-apoptotic Bcl-2 family members (e.g. Bcl-2 and Bcl-xL) oppose these actions.

I-3.2 Death signaling at the mitochondria

Mitochondria form a point of convergence and integration of both survival and death

signaling pathways. Mitochondria communicate death signals between mitochondria and

to other organelles such as the sarco-/endoplasmic reticulum and the nucleus. The pro-

death capabilities of the mitochondrion are controlled by three main factors: MPTP

INTRODUCTION

I

10

activity, increased reactive oxygen species (ROS) production, and impaired calcium

homeostasis.

I-3.2.1 Mitochondrial permeability transition

The mitochondrial permeability transition (MPT) is a pathophysiological relevant

mechanism that leads to increased permeability of the mitochondrial membranes and

participates in both necrotic and apoptotic cell death (Kim et al., 2003). The onset of

MPT is initiated by the opening of the nonspecific large-conductance MPTP, whereby the

inner mitochondrial membrane is permeabilized to solutes of up to 1.5 kDa, causing the

collapse of ∆Ψm. It is generally thought that a minimal MPTP is composed of VDAC

(voltage dependent anion channel in the outer mitochondrial membrane), ANT (adenine

nucleotide translocator in the inner mitochondrial membrane) and cyclophilin D (a prolyl

isomerase located in the matrix) (Crompton, 2000). Under normal conditions, both

VDAC and the ANT are involved in the delivery of ATP from the mitochondrial matrix

to the cytosol. The function of the prolyl isomerase cyclophilin D in the mitochondrial

matrix is still subject to investigation. However, under certain pathophysiological

conditions (e.g. high mitochondrial matrix calcium levels and/or enhanced oxidative

stress) these three proteins appear to be altered into forming the MPTP.

Interestingly, MPTP activation has been shown to occur upstream of Bax-

mediated cytochrome c release (De Giorgi et al., 2002; Precht et al., 2005). MPTP

activation may also amplify any cellular energetic crisis, as mitochondria become ATP

consumers, via ATP hydrolysis and reverse proton pumping by H+-ATPase (Leyssens et

al., 1996). In the heart, the MPTP has been implicated as an important factor mediating

I/R injury (Weiss et al., 2003). Both cyclosporin A (CsA) and sanglifehrin-A, inhibitors

of the MPTP, have been shown to prevent cardiac myocyte death caused by I/R in

perfused hearts (Borutaite et al., 2003; Hausenloy et al., 2003). Recently, in vivo studies

in cyclophilin D-null mice have confirmed the MPTP, or at least cyclophilin D, as a

mediator of I/R injury in the heart (Baines et al., 2005).

I-3.2.2 Mitochondrial ROS generation

Intimately linked to the mitochondrial role in PCD is their capability to generate ROS. In

the cardiac myocyte about 1-3% of the O2 that is normally reduced to H2O is converted to

INTRODUCTION

I

11

the superoxide anion (O2-˙), the upstream source of most ROS (Boveris et al., 1972). O2

-˙

production occurs by the constant slow transfer of electrons onto O2 at Complex I

(Turrens and Boveris, 1980) and the semiquinone radical of Complex III of the

mitochondrial electron transport chain (Turrens et al., 1985).

During I/R injury the return of oxygen to ischemic tissues is accompanied by an

increased production of ROS. Studies on whole hearts and isolated cells have shown that

a burst of ROS generation occurs during the first minutes after hypoxic and ischemic

tissues are reoxygenated (Zweier et al., 1987), due to the reactivation of mitochondrial

respiration (Ambrosio et al., 1993). ROS generation results in tissue lipid and protein

oxidation (Levraut et al., 2003) (Vanden Hoek et al., 1998). Antioxidant scavenging of

ROS blunts or eliminates I/R injury in vivo and in vitro (Vanden Hoek et al., 1997;

Calvillo et al., 2003; Adlam et al., 2005) and enhanced catalase expression via adenoviral

gene transfer decreased injury (Zhu et al., 2000), demonstrating that ROS play a

causative role in myocardial I/R injury.

I-3.2.3 Mitochondrial calcium handling

The cardiac myocyte requires an efficient supply and delivery of ATP from the

mitochondria to perform work and maintain ionic homeostasis. Calcium (Ca2+

), which is

stored in the sarcoplasmic reticulum (SR, specialized endoplasmic reticulum of muscle

cells) serves as a second messenger to couple mitochondrial ATP production to demand:

Ca2+

-release during the action potential (ionic exchanges at the plasma membrane which

mediate the contraction cycle) stimulates both actino-myosin ATPase activity

(contraction) and mitochondrial oxidative phosphorylation (Duchen, 2000) through

activation of the tricarboxylic acid cycle (Rizzuto et al., 2000). During the action

potential, a small amount of Ca2+

enters the cardiac myocyte through L-type channels in

the plasma membrane, triggering the large-scale release of sarcoplasmic reticulum Ca2+

stores into the cytosol (Bers, 2000). The ATP-dependent sarco/endoplasmic reticulum

calcium ATPase (SERCA), is then responsible for pumping Ca2+

from the cytosol back

into the SR during the relaxation phase (Dremina et al., 2004).

Decreased ATP production due to mitochondrial dysfunction during I/R results in

decreased SERCA activity: less Ca2+

is pumped back into the SR, leading to increased

cytosolic Ca2+

levels. The increased cytosolic Ca2+

levels may activate the Ca2+

-

INTRODUCTION

I

12

dependent calpain protease, which can activate the pro-apoptotic Bcl-2 family member

Bid (Chen et al., 2001). Furthermore, elevated cytosolic Ca2+

levels have been suggested

to lead to mitochondrial Ca2+

overload, which in turn would be causative in MPTP

opening and subsequent activation of apoptosis (Bagchi et al., 1997; Halestrap, 2006).

However, during simulated I/R in isolated adult cardiac myocytes, mitochondrial Ca2+

overload was found to be the consequence, rather than cause, of MPTP activation (Kim et

al., 2006), underscoring the importance of elucidating the events leading to mitochondrial

dysfunction.

I-3.3 Regulation of mitochondrial integrity by Bcl-2 family members

At the level of the single mitochondrion, both MPTP activity and the release of pro-

apoptotic proteins from the mitochondrial intermembrane space are regulated by two

opposing classes of the Bcl-2 (B-cell leukemia/lymphoma 2) family of death-regulating

proteins (Fig. 1). Members of the Bcl-2 protein family have either anti- or pro-apoptotic

functions (Reed et al., 1998) (Cory and Adams, 2002). Cellular stresses leading to the

execution of cell death pathways are perceived by Bcl-2 family proteins and

communicated to the mitochondria by regulated targeting of these proteins to the outer

mitochondrial membrane where they modulate the release of pro-apoptotic molecules

such as cytochrome c through interaction with other Bcl-2 family proteins. Bcl-2 family

proteins exert different activities as a function of their intracellular localization. Bcl-2

family members have also been shown to target membranes of the sarco-endoplasmatic

reticulum (S/ER), and the nuclear envelope where they excert additional/alternate pro- or

anti-apoptotic functions in part by regulating organelle calcium content and trafficking

events (Marin et al., 1996; Beham et al., 1997; Breckenridge et al., 2003; Xu et al.,

2005).

A common characteristic for all Bcl-2 family members is the presence of at least

one, and up to four, Bcl-2 homology (BH) domains (Fig. 2) which allow for the

formation of homo- or heterodimers between Bcl-2 proteins (Oltvai et al., 1993; Kelekar

and Thompson, 1998). The majority of Bcl-2 proteins furthermore possess a C-terminal

hydrophobic transmembrane (TM) domain for targeting to intracellular membranes, with

the exception of some BH3-only proteins.

INTRODUCTION

I

13

BH4BH4 BH3BH3 BH1BH1 BH2BH2 TMTM

BH3BH3 BH1BH1 BH2BH2 TMTM

BH3BH3 TMTM

anti-apoptotic

pro-apoptotic

BH3-only

subfamily

multidomain

subfamily

FIG. 2. Bcl-2 homology domains. Bcl-2 homology domains are a short stretch of sequences shared by the anti-apoptotic and pro-apoptotic Bcl-2 family of proteins. The anti-apoptotic Bcl-2 family members contain four Bcl-2 homology domains (BH1-BH4; e.g. Bcl-2, Bcl-xL). The pro-apoptotic Bcl-2 family can be further subdivided into the multidomain subfamily containing three Bcl-2 homology domains (BH1-BH3; e.g. Bak, Bax) and the BH3-only subfamily (BH3; e.g. Bid, Bnip3). In addition, most Bcl-2 proteins have a C-terminal hydrophobic transmembrane (TM) domain for targeting to intracellular membranes. Exceptions are found in the BH3-only subfamily (e.g. Bid).

I-3.3.1 Anti-apoptotic Bcl-2 family members

The anti-apoptotic members, including Bcl-2 and Bcl-xL, posses four Bcl-2 homology

domains (BH1-BH4) and potently inhibit apoptosis in various settings through the

sequestration of pro-apoptotic Bcl-2 family members via heterodimerization (Antonsson,

2004). Bcl-2 is always associated with intracellular membranes (i.e. the outer

mitochondrial membrane, S/ER and nuclear envelope) (Krajewski et al., 1993). Bcl-xL is

found in association with intracellular membranes and in addition exists in a soluble form

in the cytosol which translocates to the mitochondria during apoptosis (Wolter et al.,

1997). At the mitochondria both Bcl-2 and Bcl-xL have also been shown to stabilize the

MPTP and block the release of mitochondrial apoptogenic factors following cell death

stimuli (Susin et al., 1996). At the S/ER, Bcl-2 and Bcl-xL increase the permeability of

the S/ER to calcium, minimizing the Ca2+

signaling component of apoptosis (Chami et

al., 2004).

Anti-apoptotic Bcl-2 proteins have potent cardioprotective effects. Both Bcl-2

and Bcl-xL have been shown to protect against I/R injury in vivo (Brocheriou et al., 2000;

Imahashi et al., 2004; Huang et al., 2005). Gene transfer of Bcl-xL reduced cardiac cell

apoptosis following cold preservation and warm reperfusion of rat cardiac transplants

INTRODUCTION

I

14

(Huang et al., 2005). Furthermore, elevated Bcl-2 protein levels were reported to

coincide with the onset of protection during myocardial stunning (Depre et al., 2004).

I-3.3.2 Pro-apoptotic Bcl-2 family members

The pro-apoptotic members either contain three Bcl-2 homology domains (BH1-BH3;

e.g. Bax and Bak) or a single BH3 domain (‘BH3-only’; e.g. Bid and Bnip3). Bax and

Bid reside largely in the cytosol (or loosely bound to the mitochondria) and translocate to

the mitochondria following a pro-death stimulus (Wolter et al., 1997; Gross et al., 2004).

Once activated, Bax (Bcl-2 associated X protein) undergoes a conformational change,

allowing for its C-terminal end to be inserted into the mitochondrial outer membrane

(Goping et al., 1998; Nechushtan et al., 1999). Membrane insertion is followed by

oligomerization, an event thought to precede cytochrome c release (Shimizu et al., 1999;

Saito et al., 2000). It has been proposed that Bax, together with activated Bid, forms

channels directly via its oligomerization (Lim et al., 2002), regulate the pore size of the

VDAC to allow cytochrome c translocation (Shimizu et al., 1999) or cause membrane

instability to open lipidic channels (Degli Esposti, 2002).

The ‘BH3-only’ family member Bid (Bcl-2 interacting domain) lies within the

extrinsic death receptor pathway, and upon its activation serves to bridge the intrinsic and

extrinsic pathways. Following TNF-α or Fas treatment, Bid is cleaved by caspase 8

generating the C-terminal product tBid (truncated Bid), which is myristoylated and

translocates to the mitochondria (Zha et al., 2000). Bid can also be activated during

reperfusion by calpain cleavage (Chen et al., 2001). Bid has been proposed to both

directly participate in the mitochondrial outer membrane permeabilization event (Yuan

et al., 2003), as well as amplify the pro-apoptotic signaling of Bax either through direct

interaction with Bax/Bak (Saito et al., 2000; Wei et al., 2000), or through scavenging of

anti-apoptotic Bcl-2 and Bcl-xL, which oppose Bax activity (Wang et al., 1996; Cheng et

al., 2001). During I/R injury Bid and Bax play crucial roles in the commitment to cell

death, as demonstrated in both Bid (Peng et al., 2001) and Bax (Hochhauser et al., 2003)

knockout mice, where infarcts following I/R in the isolated heart were largely reduced.

Bnip3 (Bcl-2/adenovirus E1B 19 kDa interacting protein) is another member of

the ‘BH3-only’ Bcl-2 subfamily which has been described to induce apoptotic (Kubasiak

et al., 2002), necrotic (Vande Velde et al., 2000), and autophagic (Daido et al., 2004;

INTRODUCTION

I

15

Kanzawa et al., 2005) cell death. Bnip3 possesses a C-terminal transmembrane (TM)

domain which is required for its pro-apoptotic function, including targeting to the

mitochondria (Chen et al., 1997; Yasuda et al., 1998). Elevated Bnip3 protein levels

have been observed in vivo in an animal model of chronic heart failure (Regula et al.,

2002). Moreover, Bnip3 expression has been reported to be upregulated in neonatal

myocytes subjected to hypoxia, resulting in mitochondrial dysfunction and subsequent

cell death (Bruick, 2000; Kubasiak et al., 2002; Regula et al., 2002). Recently, our lab

has shown that Bnip3 contributes to I/R injury in the ex vivo heart via disruption of

mitochondrial integrity, leading to enhanced superoxide production and the release of

pro-apoptotic factors such as cytochrome c and AIF (Hamacher-Brady et al., 2006).

I-4 Autophagy – at the interface between death and survival

Autophagy (Greek for: ‘self-digestion’), is under normal conditions a process for the

turnover and recycling of long-lived macromolecules and organelles via the lysosomal

degradative pathway, involved in maintaining cellular homeostasis, differentiation, and

tissue remodeling. Paradoxically, under pathophysiological conditions, autophagy may

serve a protective role or contribute to cell damage. For example, nutrient depletion

classically induces autophagy in order to provide amino acids for the synthesis of

essential proteins, thus prolonging cell survival (Klionsky and Emr, 2000). Moreover,

autophagy may up to a certain threshold counteract apoptosis (PCD type I) (Boya et al.,

2005; Ravikumar et al., 2006). Other studies, however, have shown that autophagy can

act as a second type of programmed cell death, termed PCD type II (Yu et al., 2004;

Canu et al., 2005). Interestingly, autophagy shares common molecular regulators with

apoptosis, such as anti-apoptotic members of the Bcl-2 family proteins (Liang et al.,

1998; Shimizu et al., 2004), indicating a possible crosstalk between the two pathways.

I-4.1 Molecular mechanism of autophagy

Three main pathways lead to the lysosome via autophagy: macroautophagy,

microautophagy, and chaperone-mediated autophagy (Klionsky and Emr, 2000; Cuervo,

2004). During chaperone-mediated autophagy, proteins are delivered to the lysosome via

the chaperone Hsc73 (heat shock cognate protein 73) (Cuervo and Dice, 1996).

INTRODUCTION

I

16

Microautophagy describes the process whereby proteins are locally taken up by the

lysosome. Macroautophagy (hereafter referred to as autophagy), the most active form of

autophagy and a focus of this thesis, is a specific mode of autophagy in which isolation

membranes envelope a portion of the cytosol, containing non-specific cytosolic

components, selectively targeted toxic protein aggregates (Ravikumar et al., 2004),

intracellular pathogens (Gutierrez et al., 2004a), or organelles such as mitochondria (Xue

et al., 2001; Priault et al., 2005). The autophagosomes undergo a series of maturation

steps via fusion with endosomal vesicles and are then delivered to the lysosome, forming

the autophagolysosome, for subsequent degradation of their contents by lysosomal

proteases (Fig. 3).

Autophagosome

Lysosome

AutophagolysosomePhagophore

(1) (2) (3)

FIG. 3. Macroautophagy is a three-step process. (1) Macroautophagy first involves the sequestration of a region of the cytosol, containing proteins and/or organelles, which are engulfed by a newly formed double-membrane organelle, the autophagosomes. (2) To accomplish degradation of the autophagosomes and its cargo (●), the autophagosomes mature via fusion with endosomal vesicles and, subsequently, with the acidic lysosome, generating the autophagolysosome. (3) Within the autophagolysosome lysosomal proteases (▲) degrade the inner autophagosomal membrane and cargo.

I-4.1.1 Autophagosome formation

The autophagic process is initiated by the formation of an isolation membrane (or

phagophore), possibly derived from the S/ER (Juhasz and Neufeld, 2006), which engulfs

portions of the cytoplasm to generate a closed, double-membrane structure, the

autophagosome. Two ubiquitin-like conjugation systems which are well conserved

among eukaryotes are required for the formation of the autophagosome. One involves the

INTRODUCTION

I

17

attachment of Atg12 to Atg5 and the other the conjugation of phosphatidylethanolamine

to LC3/Atg8 (Fig. 4).

Atg12 is a modifier protein which is irreversibly conjugated to Atg5, independent

of autophagy induction (Mizushima et al., 1998a; Mizushima et al., 1998b). Atg7 (an

ubiquitin-activating E1-like enzyme) activates Atg12 in an ATP-dependent manner, by

binding to its C-terminal glycine. Subsequently, the C-terminal glycine of Atg12 is

transferred to Atg10 (an ubiquitin-conjugation E2-like enzyme). Atg10 in turn activates

the conjugation of Atg12 C-terminal glycine to Atg5 lysine 130. Atg16 dimerizes and

forms a complex with a pair of Atg12-Atg5 and this complex evenly associates with the

crescent shaped phagophore. Curvature is thought to be introduced via subsequent

asymmetrical redistribution of the Atg12-Atg5.

Atg16 complex mainly to the convex

surface of the phagophore. Upon completion of autophagosomes formation, Atg12-

Atg5.

Atg16 complexes dissociate from the membrane (George et al., 2000) and are not

present in the mature autophagosome. Atg12-Atg5 conjugation is indispensable for the

involvement of Atg5 in the elongation of the initial phagophore (Mizushima et al., 2001).

The development of the phagophore into the autophagosome requires the

cooperation of microtubule-associated protein light chain 3 (LC3/Atg8) (Tanida et al.,

2004). LC3 is synthesized as a cytosolic full-length precursor protein which is converted

into LC3-I via cleavage by the cysteine protease Atg4, exposing its C-terminal glycine

residue (Kirisako et al., 2000). The glycine residue is then activated by Atg7 (E1-like) in

an ATP-dependent manner, transferred to Atg3 (E2-like), and finally conjugated to the

phospholipid phosphatidylethanolamine (PE) through an amide bond (Marino, Uria et al.

2003). LC3-PE (or LC3-II) is then recruited to the autophagosomal membrane in an

Atg5-dependent manner (Mizushima et al., 2001; Kabeya et al., 2004), a process that is

required for the execution of autophagy (Kirisako et al., 2000). A lysine-130-arginine

(K130R) mutation of Atg5 prevents binding of Atg12 without interfering with membrane

targeting of Atg5 (Mizushima et al., 1998b; Pyo et al., 2005). Importantly, Atg5(K130R)

is unable to recruit LC3 and results in failed phagophore maturation. As opposed to

Atg12-Atg5, LC3-II is present in the early phagophores and matured autophagosomes

where it ultimately is degraded by lysosomal proteases (Kirisako et al., 1999). Atg4 can

deconjugate PE from LC3-II located in the outer autophagosomal membrane, converting

INTRODUCTION

I

18

it back to cytoplasmic LC3-I (Kabeya et al., 2004), although most LC3-II is degraded by

the lysosome (Tanida et al., 2005). The C-terminal end of LC3 is acting as an interface

for interacting with autophagosomal membranes, while its amino-terminal end is required

for its binding to tubulin and microtubules (Kouno et al., 2005). Coupled to GFP, LC3

serves as a specific and unique fluorescent marker for autophagosomal structures

(Mizushima et al., 2004).

Atg16

Atg16

LC3-II

Atg12

Atg12

Atg5Atg12

Atg5

LC3-II

PE

LC3-II formation

LC3-I

E1

E2

Atg7

Atg3

Atg4

Atg12

Atg5

Atg7E1

E2 Atg10

Atg12

Atg5

Atg12-Atg5 conjugation

Elongation Sequestration

Autophagosome

LC3-II

LC3-II

Phagophore

LC3-II

LC3-I

LC3

Atg4

Atg16Atg5

Atg16

Atg5Atg12

Atg16

Atg16

Atg12

Atg5Atg12

Atg5

FIG. 4. Two ubiquitin-like conjugation systems during autophagosome formation. Atg12 and LC3/Atg8 are ubiquitin-like proteins which during autophagosome formation are conjugated to Atg5 and PE, respectively. Atg12 is activated and bound by E1-like Atg7, transferred to E2-like Atg10, and conjugated to Atg5. Homodimers of Atg16 bind a pair of Atg12-Atg5 conjugates and this complex transiently associates with the forming autophagosomal membrane. The membrane-bound Atg12-Atg5

.Atg16 complex is a prerequisite for the recruitment of LC3-II, which

is the product of the second ubiquitin-like conjugation. Initially, the cysteine protease Atg4 removes the C-terminal arginine residue of cytosolic LC3, generating LC3-I with a revealed glycine residue. LC3-I is then activated by E1-like Atg7, transferred to E2-like Atg3, and conjugated to PE. The resulting LC3-II is recruited into the forming autophagosomal membrane. After completion of autophagosomes formation, a second cleavage by Atg4 results in some removal of PE from LC3-II, reverting it back into LC3-I which is released from the membrane. The remaining membrane-attached LC3-II is degraded by lysosomal proteases.

INTRODUCTION

I

19

I-4.1.2 Autophagosome maturation

Following the completion of autophagic sequestration, the autophagosome undergoes a

series of maturation steps prior to its fusion with the lysosome. During the multi-step

maturation process, autophagosomes fuse with endosomal vesicles and protease-

containing late endosomal compartments and finally, lysosomes (Gordon et al., 1992

1992; Dunn, 1994).

These fusion events are mediated in part by a family of Rab GTPases, known

mediators of vesicular trafficking, whose functions include vesicle formation, motility,

and tethering to their target compartment (Zerial and McBride, 2001). Upon membrane

fusion, Rab-bound GTP is hydrolyzed to GDP, and inactive Rab-GDP is bound by a Rab

GDP-dissociation

inhibitor (RabGDI), removing Rab to its original membrane

compartment. Rab7 is a key component in the regulation of autophagosomal maturation:

overexpression of a dominant negative mutant of Rab7 has been shown to inhibit fusion

between autophagosomes and the late endosome/lysosomal compartment (Gutierrez et

al., 2004b; Jager et al., 2004). Lysosomal receptor protein Lamp2 is involved in Rab7-

mediated fusion of autophagosomes and lysosomes as RNAi knockdown results in

retarded recruitment of Rab7 to autophagosomal membranes (Jager et al., 2004), and the

accumulation of autophagosomes (Eskelinen et al., 2004; Gonzalez-Polo et al., 2005b).

Also the cytoskeleton also regulates autophagosome formation as well as

endosomal and lysosomal trafficking (Aplin et al., 1992). Pharmacologic inhibition of

microtubules with nocodazole blocks fusion between autophagosomes and lysosomes,

evidencing its role in autophagosomal formation and delivery (Kochl et al., 2006).

Autophagy is furthermore dependent on intermediate filaments (Blankson et al., 1995).

I-4.1.3 Degradation within the autophagolysosome

The autophagosome acquires the milieu and enzymes necessary for the degradation of its

cargo through fusion with the lysosome. The lysosome is a membrane-bound organelle

which contains a cocktail of predominantly hydrolytic enzymes that are maximally active

at low pH (e.g. cathepsins B and D which degrade proteins, lipids, nucleic acids, and

polysaccharides). Acidification of the lysosomal lumen is accomplished by the vacuolar

H+-ATPase (v-ATPase), which hydrolyses cytosolic ATP to translocate H

+ into the

lysosomal lumen (Sun-Wada et al., 2003). Lysosomal transport

proteins such as

INTRODUCTION

I

20

cystinosin are thought to mediate the recycling of degraded products (amino acids,

sugars, and nucleotides) from the lysosome back to the cytosol (Winchester, 2001),

hereby completing the catabolic process.

I-4.2 Regulation of autophagy

Two pathways, which are conserved among eukaryotes, are involved in regulating

autophagic activity at the level of induction: one involves class I phosphatidylinositol 3-

kinase (PI3-K), which suppresses autophagy, and the other activation of autophagy by

class III PI3-K (Fig. 5).

I-4.2.1 Negative regulation of autophagy

Autophagy is suppressed by the class I PI3-K/Akt pathway (Petiot et al., 2000), which is

involved in anabolic metabolism (Chang et al., 2004; Hanada et al., 2004). Within this

pathway mTOR (mammalian target of rapamycin) is a central downstream effector

kinase which mediates the cellular response to nutrients, amino acids and mitogens

(Schmelzle and Hall, 2000). In the presence of amino acids and growth factors, mTOR

activates the p70S6 kinase (p70S6K), which phosphorylates the ribosomal protein S6,

resulting in the upregulation of the translational machinery. In addition, mTOR

phosphorylates and thereby deactivates the initiation factor 4E-BP1 (4E binding protein).

Deactivated 4E-BP1 then dissociates from the initiation factor eIF4E which is the rate-

limiting step in protein synthesis. Inhibiting mTOR activity with the immunosuppressant

rapamycin (Blommaart et al., 1995) increases the catabolic process of autophagy, even in

the presence of nutrients (Noda and Ohsumi, 1998). The negative control of mTOR over

autophagy is a generally accepted phenomenon (Shintani and Klionsky, 2004), however,

the underlying mechanism is largely unknown.

I-4.2.2 Positive regulation of autophagy

Beclin1/Atg6, the first mammalian protein described to mediate autophagy (Liang et al.,

1999), is a coiled-coil, myosin-like Bcl-2-interacting protein which engages class III PI3-

K/Vps34 to positively regulate autophagy (Kihara et al., 2001a; Zeng et al., 2006).

Beclin1 has been shown to colocalize with the S/ER, mitochondria (Liang et al., 2001),

and Golgi (Kihara et al., 2001a). Typically all Beclin1 forms a complex with Vps34,

whereas ~50% of Vps34 is not associated with Beclin1 (Kihara et al., 2001a). The

INTRODUCTION

I

21

specific product of Vps34, phosphatidylinositol 3-phosphate (PI3-P), is a lipid second

messenger which mediates the formation of autophagosomes (Schu et al., 1993; Petiot et

al., 2000). Furthermore, the yeast homologues of Beclin1 and Vps34 have been shown to

mediate intracellular vesicle trafficking, including endosomes and transport of lysosomal

proteases from the Golgi to the lysosome (Kihara et al., 2001b; Obara et al., 2006).

However, in mammalian cells the role of Beclin1-Vps34 in trafficking and protein sorting

remains controversial (Kihara et al., 2001a; Row et al., 2001; Obara et al., 2006).

Beclin 1

Class III PI3-K

mTOR

Class I PI3-K

Lysosome

Autophagolysosome

(3) (4)

(1)

(2)

AutophagosomePhagophore

PI3-P

Rab7Atg12-Atg5.Atg16

LC3-II

LC3-I

PE

Rapamycin

FIG. 5. Molecular mechanism and regulation of autophagy. (1) Induction of autophagy requires activity of Beclin1 and its interacting partner, class III PI3-K (Vps34), resulting in the generation of PI3-P; and it is negatively regulated by class I PI3-K through mTOR. (2) Formation of the phagophore requires conjugation of Atg12 to lysine 130 of Atg5 as a prerequisite for recruiting LC3-II. (3) Sequestration of cytoplasmic material may be nonspecific or selective; mechanisms that may govern selectivity are incompletely understood. (4) Degradation of the autophagosomes and its cargo is accomplished after sequential fusion events with endosomes and finally lysosomes. Transport and fusion events are mediated by Rab GTPases, with Rab7 being a major player in autophagy. Beclin1-Vps34 activity might further be involved in lysosomal protein sorting (not shown).

I-4.3 Cross-talk of autophagy and apoptosis: Bcl-2 family members

Interest in autophagy is at present increasing, due in part to the recognition of its

involvement in caspase-independent PCD (PCD type II) and its interaction with

components of the apoptotic death pathway (PCD type I) (Saeki et al., 2000; Yanagisawa

et al., 2003; Shimizu et al., 2004).

INTRODUCTION

I

22

I-4.3.1 Anti-apoptotic Bcl-2 family members

Beclin1 was initially identified as a Bcl-2 interacting protein using a yeast two-hybrid

screen (Liang et al., 1998). Following, it was established that the Bcl-2 binding domain

of Beclin1 serves as a point of crosstalk between the autophagic and apoptotic pathways,

at the level of autophagy induction. Interestingly, it seems that only anti- but not pro-

apoptotic Bcl-2 family members can interact with this domain (Liang et al., 1998). Bcl-2

downregulation has been shown to increase autophagy in HL60 cells (Saeki et al., 2000),

while overexpression of Bcl-2 or Bcl-xL increased the autophagic response to etoposide

treatment in MEF cells (Shimizu et al., 2004). Recently, Bcl-2 was shown to suppress the

autophagic response to starvation (Pattingre et al., 2005). Clearly, the nature of the

relationship is not yet fully understood and merits further investigation. It is likely that

the regulation of autophagy through Bcl-2 is a function of both cell type and stimulus.

I-4.3.2 Pro-apoptotic Bcl-2 family members

The BH3-only proteins Bid and Bnip3 also constitute a point of crosstalk between the

apoptotic and autophagic pathways. Bid can be activated by lysosomal cathepsin

proteases which are released into the cytosol during some forms of PCD (Stoka et al.,

2001; Cirman et al., 2004). Moreover, Bid itself has recently been shown to cause

destabilization of lysosomes and release of cathepsin B (Werneburg et al., 2004;

Guicciardi et al., 2005), forming an amplification event for mitochondrial apoptosis. In

MCF-7 cells exposed to camptothecin, RNAi silencing of Bid inhibited apoptosis and

enhanced autophagy, suggesting that Bid may function as a ‘switch’ between the

different modes of PCD (Lamparska-Przybysz et al., 2005).

Upregulation of Bnip3 has been shown to correlate with ceramide-induced

accumulation of autophagosomes in malignant glioma cells (Daido et al., 2004).

Similarly, arsenic trioxide-induced PCD correlated with elevated levels of Bnip3 and

enhanced presence of autophagosomal structures (Daido et al., ; Kanzawa et al., 2005).

Furthermore, in these studies expression of the dominant-negative transmembrane

domain deletion mutant of Bnip3 prevented the observed changes in autophagy, while

overexpression of Bnip3 was sufficient to induce increased steady-state levels of

autophagosomes in the absence of ceramide or arsenic trioxide. The authors concluded

INTRODUCTION

I

23

that ceramide- and arsenic trioxide-induced Bnip3-mediated PCD is autophagic, however

a causative role of autophagy in cell death was not established.

I-4.4 Autophagy in the heart

Autophagy is a vital process in the heart, presumably participating in the removal of

dysfunctional cytosolic components, and serving as a catabolic energy source during

times of starvation. For example, autophagy in cardiac myocytes has been suggested to

provide a necessary source of energy between birth and suckling (Kuma et al., 2004), and

in a GFP-LC3 transgenic mouse, cardiac myocytes from starved animals displayed high

numbers of autophagosomes, some of which contained mitochondria (Mizushima et al.,

2004).

Impaired autophagy may play a causative role in cardiac disease. Incomplete

autophagic turnover of ‘old’ mitochondria may be the source of lipofuscin, a toxic waste

product which builds up during the lifespan (Brunk and Terman, 2002). Danon disease,

is caused by decreased levels of Lamp2 (Saftig et al., 2001; Horvath et al., 2003), a

lysosomal receptor which mediates the fusion process between autophagosomes and

lysosomes (Gonzalez-Polo et al., 2005a). Recently it was shown that Danon disease-

related cardiomyopathy develops as a result of extensive vacuolization in cardiac

myocytes and interference with the contractile function (Stypmann et al., 2006).

Furthermore, disruption of the autophagic pathway may contribute to myocardial cell

death under conditions where lysosomal integrity is lost and lysosomal proteases are

released into the cytosol (Decker et al., 1980).

Importantly, autophagy may serve as a protective response to myocardial I/R

injury, as increased prevalence of autophagosomes has been documented in response to

sub-lethal ischemia in the perfused heart (Decker et al., 1980). Moreover, it was recently

reported that in an in vivo model of myocardial stunning the onset of protection correlated

with increased Beclin1 expression (Yan et al., 2005). Controversially, other correlative

studies indicate that autophagic cell death (PCD type II) occurs in the failing heart.

Autophagosomes are widely reported to be increased in heart disease (Knaapen et al.,

2001; Shimomura et al., 2001; Saijo et al., 2004; Miyata et al., 2006), and in response to

myocardial hibernation (Elsasser et al., 2004) and Diphtheria toxin-activated myocardial

cell death (Akazawa et al., 2004).

INTRODUCTION

I

24

I-5 Thesis objectives

Enhancing survival of cardiac tissues following I/R is a crucial goal in cardiovascular

research. One characteristic of myocardial I/R injury is the prevalence of

autophagosomes. However, the role of autophagy in this pathophysiology is unclear.

Two hypotheses are proposed here:

(1) Autophagy functions as a cytoprotective mechanism to oppose I/R injury.

(2) The protection exerted by autophagy is in part due to the degradation of

malfunctioning mitochondria.

Thus, overall goal of this body of work was to quantify the relationship between

I/R-activated mitochondrial death pathways and autophagy. To do so we sought to

systematically perturb the apoptotic and autophagic signaling pathways, in order to

determine and quantify cause and effect. High-resolution fluorescence imaging was

employed as the main tool as it allows spatial and temporal detection of events in the

single live cell.

I-5.1 Cell culture model of I/R injury to the heart

A cell-based model of I/R is a prerequisite for studies aimed at elucidating signaling

pathways in myocardial I/R injury. However, for our purposes to date no satisfactory

model existed that combined high comparability to the in vivo situation with the high

capacity for manipulation of cell culture models. Thus, the goal of Chapter III was to

develop a unique model for studying the multiple pathways during I/R injury. Using the

recently established cardiac cell line HL-1, which is novel in its high degree of molecular

and physiological similarity to the adult cardiac myocyte, the spatio-temporal dynamics

of mitochondrial dysfunction, and the activities pro-apoptotic Bcl-2 family members Bax

and Bid were studied to establish quantifiable parameters of pro-death signaling leading

to mitochondrial dysfunction in I/R.

I-5.2 Elucidation of the regulation of Beclin1-mediated autophagy

To date the nature of control of anti-apoptotic Bcl-2 family members over Beclin1-

mediated autophagy is unclear. In part this is due to incorrect use of tools available for

detecting the autophagic response. The goal of Chapter IV was to develop a method for

the specific and quantitative assessment of macroautophagic activity, and subsequently to

INTRODUCTION

I

25

determine how Beclin1-mediated autophagy is regulated by Bcl-2 in the HL-1 cardiac

myocyte.

I-5.3 Role of Beclin1-mediated autophagy in myocardial I/R injury

To date studies on the role of autophagy in the heart are correlative and it remains to be

determined if, and under which conditions, autophagy represents a protective or

detrimental cellular mechanism. Using the our established model of I/R injury in HL-1

cells together with the techniques developed for investigating autophagy, the goal of

Chapter V was to elucidate the role of Beclin1-mediated autophagy in cardiac I/R injury.

The goal of Chapter IV through pharmacologic and molecular approaches while

monitoring the effect on cellular injury.

I-5.4 Connection between mitochondrial dysfunction and autophagy

Bnip3 is a pro-apoptotic Bcl-2 protein which contributes to myocardial I/R injury by

causing mitochondrial dysfunction. On the premise that mitochondrial dysfunction plays

a key role in I/R injury and autophagy is capable of scavenging damaged mitochondria,

we hypothesized that during I/R, Bnip3 promotes autophagy of malfunctioning

mitochondria. The goal of Chapter VI was to investigate the connection between I/R

injury, Bnip3-induced mitochondrial dysfunction, and mitochondrial autophagy in the

HL-1 cardiac myocyte.

Chapter 2

Materials and Methods

________________________________________________________________________

MATERIALS & METHODS

II

29

II-1 Materials

Reagents for the production of solutions, buffers, and media were purchased from Sigma-

Aldrich (St. Louis, MO, USA). Materials for HL-1 cell culture were obtained from JRH

Biosciences (Lenexa, KS, USA), BD Biosciences (San Jose, CA, USA), and Sigma-

Aldrich. Pharmacologicals were purchased from EMD Biosciences (La Jolla, CA,

USA). Fluorescent dyes were obtained from Invitrogen (Carlsbad, CA, USA).

Antibodies were obtained from Abcam (Cambridge, MA, USA), BD Biosciences -

Clontech (Mountain View, CA, USA), Caltag (Burlingame, CA, USA), R&D Systems

(Minneapolis, MN, USA), Santa Cruz (Santa Cruz, CA, USA), and Sigma-Aldrich.

Materials for Western blotting were purchased from Bio-Rad (Hercules, CA, USA) and

Pierce (Rockford, IL, USA). Kits and enzymes for DNA techniques and transfection

reagents were purchased from Qiagen (Valencia, CA, USA), New England Biolabs

(Ipswich, MA, USA), Stratagene (La Jolla, CA, USA), and Invitrogen. Consumables

were bought via Fisher Scientific (Tustin, CA, USA) from the following suppliers:

Corning (Corning, NY, USA), and BD Biosciences. Pipet-tips were from Myriad (San

Diego, CA, USA). Glass-bottom microwell dishes were obtained from MatTek

(Ashland, MA, USA).

II-1.1 Antibodies

II-1.1.1 Primary antibodies

Antibody against Description Source

Actin clone AC-40; mouse monoclonal Sigma-Aldrich

Atg5 3H2201; chicken polyclonal Abcam

Bcl-2 C-2; mouse monoclonal Santa Cruz

Bcl-xL H-5; mouse monoclonal Santa Cruz

Beclin1 D-18; goat polyclonal Santa Cruz

Bid rat monoclonal R&D Systems

Bnip3 mouse monoclonal Sigma-Aldrich Drp1 (= Dlp1) mouse monoclonal BD Biosciences

Fluorescent Protein mouse monoclonal BD Biosciences

RhoGDI mouse monoclonal BD Biosciences

MATERIALS & METHODS

II

30

II-1.1.2 Horseradish peroxidase-conjugated secondary antibodies

Description Source

Goat anti-mouse IgG (H+L) Caltag

Goat anti-rabbit IgG (H+L) Caltag

Swine anti-goat IgG (H+L) Caltag

Goat anti-rat IgG (H+L) Caltag

Rabbit anti-chicken IgY (H+L) Abcam

II-2 Methods

II-2.1 Cloning and plasmid construction

The DNA sequences of interest were amplified from the indicated template via PCR

(polymerase chain reaction) (Mullis et al., 1986) using primers (listed in the appendix: X-

2) containing restriction sites according to the MCS (multiple cloning site) of the vector

(Scharf et al., 1986). Primer design was done using the nucleic acid analysis and

modeling tools of the web-based SDSC Biology Workbench

(http://workbench.sdsc.edu/). All primers where synthesized by Allele Biotech (San

Diego, CA, USA).

Standard PCR reaction mix1:

5 ng Template

0.5 µM each Oligonucleotides (‘primer’)

250 µM Desoxynucleotides (dNTPs)

1X Pfu DNA Polymerase Reaction Buffer

1 µl PfuTurbo DNA Polymerase (Stratagene) 1 final volume: 40 µl per reaction, adjusted with MilliQ-H2O.

Standard PCR program:

Cycle Reaction Temperature Duration Loops

1 (Lid heat) 110°C

2 Denaturing 95°C 1:00 min 1 x

3 Denaturing 95°C 1:00 min

Annealing 54°C 0:30 min 30 x (Cycle 3)

Synthesis 72°C 1:00 min

4 “Fill-in” 72°C 10:00 min 1 x

5 Reaction stop 4°C forever

MATERIALS & METHODS

II

31

Subcloning of PCR products into mammalian expression vectors was performed using

standard methods of molecular biology (CPMB). PCR products were purified by size-

separation on 1% (w/v) agarose gels and subsequent QIAEX II gel extraction (Qiagen).

Following, both vector and PCR-products were digested with the appropriate restriction

enzymes. After gel purification, vector and PCR-products were ligated using T4 DNA

ligase (Invitrogen). The obtained plasmids were transformed into bacteria of the

Escherichia coli strain DH5α (Invitrogen) for amplification. Transformed bacteria were

selected with the help of vector-encoded antibiotic resistance. Plasmid DNA was

purified from DH5α over-night cultures using the QIAprep Miniprep kit (Qiagen) and

sequence verified (TSRI DNA core lab). Vector maps were generated using pDraw32

DNA analysis freeware (AcaClone software, http://www.acaclone.com/) and gathered in

the appendix (X-6).

II-2.1.1 pmCherry-C1

mCherry was amplified from the pRSET-mCherry vector (Shaner et al., 2004), with the

forward (5’-GTAACCGGTATGGTGAGCAAGGGCGAG-3’) and reverse (5’-

GTAAGATCTCTTG TACAGCTCGTCCATGC-3’) primers. AgeI and BglII restriction

sites (underlined) were added to 5’ and 3’ cDNA ends, respectively. mCherry was

swapped with EGFP of the vector pEGFP-C1, generating the pmCherry-C1 vector.

II-2.1.2 mCherry-Bax

Human Baxα was amplified from pEGFP-Bax (Wolter et al., 1997), with the forward (5’-

GTAAGATCTATGGACGGGTCCGGGGAG-3’) and reverse (5’-

GTAGAATTCTCAGCCCACT TCTTCCAGATGGTG-3’) primers BglII and EcoRI

restriction sites (underlined) were added to 5’ and 3’ cDNA ends, respectively. Human

Baxα was inserted into pmCherry-C1 at the BglII and EcoRI restriction sites.

II-2.1.3 Mito-ECFP

ECFP was excised from pECFP-N1 at restriction sites BamHI and NotI. DsRed2 was

removed from the mito-pDsRed2 vector (Clonetech) at restriction sites BamHI and NotI,

and replaced with ECFP to generate the mito-ECFP vector.

MATERIALS & METHODS

II

32

II-2.1.4 YFP-Bid-CFP

YFP-Bid-CFP was generated using the improved versions of YFP, Venus (Nagai et al.,

2002), and CFP, Cerulean (Rizzo et al., 2004). Human full-length Bid, Venus, and

Cerulean were amplified by PCR using end primers containing the required restriction

sites to generate (KpnI)YFP-(XhoI)-Bid-(SphI)-CFP(NotI). The obtained ligation product

was subcloned into pcDNA3.1(+) using the KpnI and NotI sites.

II-2.1.5 mCherry-Atg5

Atg5 cDNA was amplified from mouse cDNA library (Invitrogen) with the forward (5’-

GTACTCGAGGGATGACAGATGACAAAGATGTG-3’) and reverse (5’-

GTAGGATCCATCTGTTGGCTGGGGGAC-3’) primers. Primers were designed to

remove the stop codon and add XhoI and BamHI restriction sites (underlined) to 5’ and 3’

ends, respectively. Atg5 was then ligated into pmCherry-C1 vector at the XhoI and

BamHI restriction sites.

II-2.2 Site-directed mutagenesis

Site-directed mutagenesis was employed to investigate the role of specific proteins in

autophagy and apoptosis. The desired mutations were inserted into wild-type cDNA by

PCR, using two complementary oligonucleotides containing the altered codon (Higuchi

et al., 1988; Weiner et al., 1995). Template cDNA encoding the gene of interest was

amplified by PCR using the restriction site-containing primers used for the amplification

and cloning of wild-type constructs (II-2.1). To insert the mutation, two PCR reactions

were performed, amplifying the 5’template end with the 5’Forward primer and 3’Reverse

mutant primer, and amplifying the 3’template end with the 5’Forward mutant primer and

3’Reverse primer. The PCR products were separated on 1% (w/v) agarose gels and

extracted using the QiaQuick Gel Extraction Kit (Qiagen). Another PCR was performed

on the purified 5’ and 3’ ends. During PCR, the overlapping segments corresponding to

the mutant primer sequences, anneal and the DNA polymerase extends the 3’ ends to

generate full length cDNA. The reaction was then spiked with template 5’Forward and

3’Reverse primers to amplify the cDNA containing the desired mutation.

MATERIALS & METHODS

II

33

II-2.2.1 mCherry-BaxT182A

The threonine 182 to alanine (T182A) point mutation within human Baxα was generated

using site directed mutagenesis. The T182A mutation was inserted using the forward

primer 5'-GGGAGTGCTCGCCGCCTCACTCACCATCTGG-3' and its complementary

reverse primer 5'- CCAGATGGTGAGTGAGGCGGCGAGCACTCCC-3'. The construct

was inserted into the pmCherry-C1 vector.

II-2.2.2 YFP-Bid∆casp8-CFP

To generate YFP-Bid∆casp8-CFP, wild-type Bid in YFP-Bid-CFP was exchanged

against Bid∆casp8 which had previously been obtained via site directed mutagenesis of

the caspase 8 cleavage site generating a aspartic acid 60 to glutamic acid (D60E) point

mutation using the forward primer 5’-GAGCTGCAGACTGAGGGCAACCGCAGC

AGC-3’ and the complementary reverse primer 5’-GCTGCTGCGGTTGCCCTCAGTCT

GCAGCTC-3’.

II-2.2.3 mCherry- Atg5K130R

The lysine 130 to arginine (K130R) point mutation within mour Atg5 was inserted using

site directed mutagenesis as previously described (Mizushima et al., 2001), using the

forward primer 5’-GTCGTGTATGAGAGAAGCTGATG-3’ and the complementary

reverse primer 5’- CATCAGCTTCTCTCATACACGAC-3’. Atg5K130R

was then ligated

into pmCherry-C1 vector at the XhoI and BamHI restriction sites.

II-2.3 RNA interference

Silencing of Bnip3 and Beclin1 was achieved using the vector-based RNAi system

BLOCK-iT™ Pol II miR RNAi Expression Vector Kit (Invitrogen). The vector

pcDNA™6.2-GW/EmGFP-miR embeds a small hairpin RNA within a microRNA fold,

which is then processed by the endogenous RNAi machinery (Amarzguioui et al., 2005).

Sequences with 100% homology to regions within the ORF (open reading frame) of the

gene of interest were generated using the BLOCK-iT™ RNAi Designer

(https://rnaidesigner.invitrogen.com/rnaiexpress). The obtained target sequences were

checked for the absence of significant homology to other proteins within the respective

species using BLAST analysis (Altschul et al., 1990). The sequence was used to generate

homologous oligonucleotide pairs (Allele Biotech; San Diego, CA, USA), which were

MATERIALS & METHODS

II

34

inserted into the pcDNA™6.2-GW/EmGFP-miR, which has co-cistronic expression of

EmGFP, allowing for determination of transfection efficiency by fluorescence

microscopy. The obtained vectors were sequence verified. To control for non-specific

RNAi effects, the construct pcDNA™6.2-GW/EmGFP-miR-LacZ (targeting beta

galactosidase) was used as control.

II-2.3.1 Bnip3

The obtained target sequence for the ORF of mouse Bnip3 was 5’-

TCCAGCCTCCGTCTCTATTTA-3’ (78-98) and showed no significant homology to

other mouse proteins. The generated oligonucleotide pairs were used to generate

pcDNA™6.2- GW/EmGFP- miR-Bnip3(78). For silencing of Bnip3, HL-1 cells were

transfected using Lipofectamine 2000. Cell lysates were prepared 48 h after transfection

and Bnip3 protein levels were assessed via Western blotting (II-2.14).

II-2.3.2 Beclin1

The obtained target sequences for the ORF of mouse Beclin1, 5’-

TGAAACTTCAGACCCATCTTA-3’ (a) and 5’-TAATGGAGCTGTGAGTTCCTG-3’

(b), showed no significant homology to other mouse proteins and were used to generate

pcDNA™6.2-GW/EmGFP-miR-Beclin1(a) and –Beclin1(b). Cells were co-transfected

with both vectors using Lipofectamine 2000 to achieve maximal knock-down of Beclin1.

96 h after transfection, Beclin1 protein levels were assessed via Western blotting.

II-2.4 Cell culture

Cells of the atrial-derived cardiac cell line HL-1 (Claycomb et al., 1998) were plated in

gelatin/fibronectin-coated culture vessels and maintained in Claycomb medium (JRH

Biosciences) supplemented with 10% fetal bovine serum, 0.1 mM norepinephrine, 2 mM

L-glutamine, 100 U/ml penicillin, 100 U/ml streptomycin, and 0.25 µg/ml amphotericin

B. Cells were passaged at 1:3 every two days and cells of the passages 70 to 80 were

used for experiments. For fluorescence microscopy, cells were plated on 25-mm-

diameter round glass coverslips (Fisher Scientific) or in the center of 14-mm-diameter

glass bottom microwell dishes (MatTek). For Western blotting, cells were plated in 6-

well-plates or 60-mm diameter dishes.

MATERIALS & METHODS

II

35

II-2.5 Transfections

Cells, which had been plated the day before, were transfected with the indicated vectors

using the transfection reagents Effectene (Qiagen) or LipofectamineTM

2000 (Invitrogen).

The manufacturer’s protocols for adherent cells were optimized for HL-1 cells achieving

on average ~40% and ~60% transfection efficiency, respectively, without detectable

toxicity.

II-2.5.1 Effectene transfection protocol

MatTek format 6-well format 60-mm format

# of cells plated 35 000 150 000 300 000

DNA 0.3 µg 0.9 µg 1.5 µg

EC buffer 65 µl 195 µl 300 µl

Enhancer 3.75 µl 10 µl 20 µl

Effectene 2.5 µl 7.5 µl 13 µl

Medium (per mix) 390 µl 600 µl 1.2 ml

Medium (per dish) 1.0 ml 1.6 ml 3 ml

The DNA was diluted in EC buffer and incubated for 5 min following addition of

Enhancer. Then, the non-liposomal lipid reagent Effectene was added and the mixture

was incubated for an additional 10 min. Fully supplemented (containing serum and

antibiotics) Claycomb medium was added and the transfection complexes were

immediately added to cells cultured in fully supplemented Claycomb medium. Medium

was exchanged after 16-24 h.

II-2.5.2 Lipofectamine transfection protocol

MatTek format 6-well format 60-mm format

# of cells plated 80 000 600 000 120 000

DNA 2.4 µg 4 µg 8 µg

+ OPTI-MEM 150 µl 250 µl 0.5 ml

LipofectamineTM

2000 3 µl 5 µl 10 µl

+ OPTI-MEM 150 µl 250 µl 0.5 ml

Medium (per dish) 1.2 ml 2 ml 5 ml

The DNA was diluted in serum-free OPTI-MEM (Invitrogen). The cationic lipid reagent

Lipofectamine 2000 was likewise diluted in serum-free OPTI-MEM and incubated for 5

min at room temperature. Following, DNA and Lipofectamine dilutions were combined

and incubated for 20 min at room temperature. Lipofectamine-DNA complexes were

MATERIALS & METHODS

II

36

added to cells cultured in antibiotic-free serum-containing Claycomb medium. The

medium was replaced after 5-8 h with fully supplemented Claycomb medium.

II-2.6 High and low nutrient condition

For high nutrient conditions, experiments were performed in fully supplemented

Claycomb medium. For low nutrient conditions, experiments were performed in Krebs-

Henseleit solution (KH, in mM: 110 NaCl, 4.7 KCl, 1.2 KH2PO4, 1.25 MgSO4, 1.2

CaCl2, 25 NaHCO3, 15 glucose, 20 HEPES, pH 7.4).

II-2.7 Simulated ischemia/reperfusion (sI/R)

For real-time fluorescence imaging, cells were plated on 25-mm-diameter round glass

coverslips. The coverslips were placed in an air-tight Leiden perfusion chamber

(Harvard Apparatus; Holliston, MA, USA), mounted on the stage of a fluorescence

microscope and subjected to 1-2 h of simulated ischemia by superfusion with ischemia-

mimetic solution (in mM: 125 NaCl, 8 KCl, 1.2 KH2PO4, 1.25 MgSO4, 1.2 CaCl2, 6.25

NaHCO3, 5 Na-lactate, 20 HEPES, pH 6.6) equilibrated with 95% N2-5% CO2, followed

by reperfusion with normoxic KH solution equilibrated with 95% O2-5% CO2.

Alternatively, cells were plated in MatTek dishes and ischemia was introduced by

a buffer exchange to ischemia-mimetic solution and placing of the dishes in hypoxic

pouches (GasPakTM

EZ, BD Biosciences). After 2 h of ischemia, reperfusion was

initiated by a buffer exchange to normoxic KH solution and incubation at 95% room air-

5% CO2. Controls incubated in normoxic KH solution were run in parallel for each

condition. Under control conditions in KH solution cell viability was not compromised.

II-2.8 Fluorescence microscopy

II-2.8.1 Widefield fluorescence microscopy

Cells were observed through a Nikon TE300 fluorescence microscope (Nikon; Tokyo,

Japan) equipped with a 10x lens (0.3 N.A., Nikon), a 40x Plan Fluor and a 60x Plan Apo

objective (1.4 N.A. and 1.3 N.A. oil immersion lenses; Nikon), a Z-motor (ProScanII,

Prior Scientific; Rockland, MA, USA), a cooled CCD camera (Orca-ER, Hamamatsu;

Hamamatsu, Japan) and automated excitation and emission filter wheels controlled by a

LAMBDA 10-2 (Sutter Instrument; Novato, CA, USA) operated by MetaMorph 6.2r4

(Universal Imaging; Buckinghamshire, UK). UV, green, and red fluorescence was

MATERIALS & METHODS

II

37

excited through an excitation filter for DAPI (D350/50x), FITC (HQ480/40x), and Texas

Red (D560/40x), respectively. Fluorescent light was collected via a polychroic

beamsplitter (61002bs) and emission filters for DAPI (D460/50m), FITC (HQ535/50m),

and Texas Red (D630/60m). DAPI, FITC, and Texas Red filters were from Chroma

(Rockingham, VT, USA). In addition, CFP fluorescence was excited through the

excitation filter XF1071, collected via the dichroic beamsplitter XF2034 and the emission

filter XF3075. YFP fluorescence was excited through the excitation filter XF1068,

collected via the dichroic beamsplitter XF2034 and the emission filter XF3074. CFP and

YFP filters were from Omega Optical (Brattleboro, VT, USA).

II-2.8.2 Laser Scanning Confocal Microscopy (LSCM)

LSCM was performed with a Bio-Rad Radiance 2100 laser scanning confocal

microscope (Hercules, CA, USA) using a 60X Plan Apo objective (1.4 N.A oil

immersion lens; Nikon), equipped with both a mixed gas Helium-Neon (543 nm) laser

and an Argon (488 nm) laser, and operated through Bio-Rad LaserSharp 2000 software.

Green and red fluorescence were directed to separate photomultipliers by a 560-nm long-

pass dichroic reflector through HQ530SP and HQ590/70 emission filters, respectively.

The confocal pinholes were configured so as to obtain images of 0.7 µm in the axial

dimension and step increments were 0.3 µm.

II-2.9 Detection of ROS and ∆∆∆∆ΨΨΨΨm

Intracellular ROS levels were assessed using chloromethyl-dichlorodihydrofluorescein

diacetate (CM-DCFH2-DA), which is predominantly retained inside mitochondria due to

covalent binding of the probe’s chloromethyl moiety to the abundant sulfhydryl groups in

the mitochondrial matrix (Presley et al., 2003). ∆Ψm was assessed using

tetramethylrhodamine methyl ester (TMRM) or Rhodamine123 (Rhod123), which

electrophoretically accumulate in the matrix of actively respiring mitochondria and are

released once ∆Ψm is impaired (Bernardi et al., 2001). For dye-loading, CM-DCFH2-DA

(10 µM) was added to the cells prior to sI/R in KH buffer and allowed to load for 30 min

at room temperature to ensure mitochondrial loading of CM-DCFH2-DA. TMRM (5 nM)

was included in the ischemia-mimetic solution or, in normoxic control cells, the KH

solution paralleling the experimental duration of 2 h ischemia simulation. Cells

MATERIALS & METHODS

II

38

expressing either mCherry-Bax or mCherry-BaxT182A

were incubated 30 min with 50 nM

Rhod123 at 37°C in HL-1 medium prior to imaging in dye-free KH solution.

II-2.10 Assessment of mitochondrial morphology

To visualize mitochondria independently of ∆Ψm, cells were transfected with a plasmid

encoding mito-DsRed2 (Clontech) or mito-ECFP (II-2.3.3), in which the fluorescent

proteins DsRed2 or ECFP are fused to the COX IV targeting sequence, thus targeting

them to the mitochondrial inner membrane (Rizzuto, Brini et al. 1995).

II-2.11 Quantification of cellular injury

II-2.11.1 Redistribution of (mCherry-)GFP-Bax

GFP-Bax (Wolter, Hsu et al. 1997) or mCherry-Bax (II-2.3.2) redistribution was used as

a parameter to quantify irreversible cellular injury. Cells were transfected with

(mCherry-)GFP-Bax and allowed to express for 48 hours. Then, cells were subjected to 2

h ischemia in hypoxic pouches followed by 5 h reperfusion and live cells were analyzed

by fluorescence microscopy. Cells were classified as cells with (i) diffuse or (ii) punctate

mitochondrial (mCherry-)GFP-Bax fluorescence. Per condition, a total of approximately

250-500 transfected cells were scored at 60x magnification in three independent

experiments.

II-2.11.2 Plasma membrane integrity

To determine Bnip3-induced cell death, HL-1 cells were co-transfected with (a) pDsRed2

and pcDNA3.1 or Bnip3, in combination with Beclin1 or Beclin1∆Bcl2BD, or (b)

mCherry and pcDNA3.1 or Bnip3, in combination with mCherry-Atg5 or mCherry-

Atg5K130R

, as indicated. 48 h after transfection, cells were stained with 0.1 µM of the

DNA intercalating dye YoPro1 which enters both apoptotic and necrotic cells, but is

excluded from healthy cells (Idziorek et al., 1995). To quantify cell death, cells were

inspected at 20x magnification and pDsRed2- or mCherry-positive cells were evaluated

for YoPro1 staining. Per condition, two replicate dishes were scored in three independent

experiments.

MATERIALS & METHODS

II

39

II-2.12 Quantification of cellular autophagosome content

Cellular contents of autophagosomal structures were quantified via fluorescence imaging

of GFP-LC3 (Mizushima et al., 2004). HL-1 cells were transfected with GFP-LC3 and

48 h after transfection, cells were subjected to sI/R as indicated. Cells were fixed with

4% formaldehyde (Ted Pella; Irvine, CA, USA) in phosphate-buffered saline (PBS, pH

7.4) for 15 min. To quantify the autophagic response among a population of cells, cells

were inspected at 60x magnification and classified as (i) cells with predominantly diffuse

GFP-LC3 fluorescence or as (ii) cells with numerous punctate GFP-LC3 structures,

representing autophagic vacuoles, AVs. A minimum of 150 cells was scored in at least

three independent experiments. For quantification of the autophagic response of single

cells, Z-stacks of GFP-LC3 fluorescence of 7-10 representative cells per condition in

three separate experiments were acquired through the 60x oil immersion lens with 0.3 µm

increments through the entire volume of the cell. Z-stacks were thresholded and total

number and volume of the autophagosome per cell was determined (AutoQuant).

II-2.13 Determination of LC3-II degradation

To analyze autophagic flux, GFP-LC3 expressing cells were subjected to the indicated

experimental conditions with and without a cocktail of the cell-permeable lysosomal

inhibitors bafilomycin A1 (100 nM, vacuolar H+-ATPase inhibitor) to inhibit lysosomal

acidification (required for protease activity (Yoshimori et al., 1991)) and autophagosome-

lysosome fusion (Yamamoto et al.), and E64D (5 µg/mL, inhibitor of cysteine proteases,

including cathepsin B), and pepstatin A methyl ester (5 µg/mL, cathepsin D inhibitor) to

inhibit lysosomal protease activity. Fluorescence microscopy of GFP-LC3 was used to

determine cellular autophagosomal content as described above.

II-2.14 Activity of the lysosomal compartment

LysoTracker Red (LTR) is a cell-permeable acidotropic probe that selectively labels

vacuoles with low internal pH and thus can be used to label functional lysosomes (Bucci,

Thomsen et al.). Following sI/R and control experiments, cells were loaded with 50 nM

LTR for 5 min in KH solution, the medium was then exchanged with dye-free KH

solution, and cells were analyzed by fluorescence microscopy. Activity and intracellular

distribution of cathepsin B, a predominant lysosomal protease, was assessed using (z-

RR)2-MagicRed-Cathepsin B substrate (B-Bridge; Sunnyvale, CA, USA). MagicRed

MATERIALS & METHODS

II

40

cathepsin B substrate (10 nM) was added to the cells during the last 30 min of an

experiment. Cells were rinsed once with PBS prior to analysis by fluorescence

microscopy.

II-2.15 Ca2+ imaging

HL-1 cells were transfected with mito-ECFP and either WT-Bcl-2, mito-Bcl-2, or S/ER-

Bcl-2 at a ratio of 1:4 µg. 48 h after transfection, cells were incubated for 20 min in 2

µM of the Ca2+

-sensitive dye Fluo-4/AM at 37°C in KH solution. Following, the dye-

containing solution was replaced with dye-free KH solution containing 100 µM

norepinephrine, and cells were further incubated for a 30 min at 37°C prior to imaging.

Mito-CFP transfected cells were visually located and 10 consecutive images (1/sec) of

Fluo-4 fluorescence were acquired. 1 µM thapsigargin was then added, let to incubate

for 1 min, and subsequently 10 consecutive images (1/sec) of Fluo-4 fluorescence were

acquired. The average change in Fluo-4 fluorescence (F) intensity (Finitial/(Ffinal-Finitial))

was determined from mean cellular image intensities using the ImageJ multi-ROI

function.

II-2.16 Image processing and analysis

For high-resolution microscopy, Z-stacks of representative cells were acquired at 40x or

60x magnification with 0.3 µm increments capturing total cellular volume. Aquired

widefield Z-stacks were routinely deconvolved using 10 iterations of a 3D blind

deconvolution algorithm (AutoQuant, Media Cybernetics; Silver Spring, MD, USA) to

maximize spatial resolution. Representative cells are shown as maximum projections of

3D-deconvolved Z-stacks, unless stated otherwise.

Image analysis and figure preparation was performed using the National Institutes

of Health public domain software ImageJ (http://rsb.info.nih.gov/ij). When required for

optimal visualization, multi-color look-up-tables (LUT) were applied to grey-scale

images. 3D images were reconstructed from Z-stacks using the volume rendering plugin

for ImageJ (VolumeJ; (Abramoff and Viergever, 2002);

http://www.isi.uu.nl/people/michael/vr.htm).

MATERIALS & METHODS

II

41

II-2.17 Immunoblotting

Cells were harvested by scraping and centrifugation at 550 g for 5 min at 4°C and washed

once with cold PBS (pH 7.4). To prepare whole cell lysates, cell pellets were redissolved

in cold RIPA buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% Triton-X 100, 0.1%

SDS, 1 mM EDTA, 1 mM Na3VO4, 1 mM NaF, and protease inhibitor cocktail (Roche))

and left on ice for 15 min. The cell extracts were centrifuged at 20 000 g for 5 min to

remove cellular debris. Protein concentrations were determined using Coomassie Plus

Reagent (Pierce) and samples were diluted for equal loading per well. After addition of

sample buffer and reducing agent (Bio-Rad) samples were incubated at 95°C for 5 min

and electrophoresed on 10% Bis-Tris SDS-PAGE gels (Bio-Rad) and transferred to

nitrocellulose membranes (Bio-Rad) according to standard methods (Laemmli, 1970).

Following, membranes were stained with Ponceau S (Pierce) to verify uniform loading

and transfer. For immunodetection the membranes were blocked in 5% dry milk in

TBST (Tris-buffered saline (TBS)-Tween; 100 mM NaCl, 10 mM Tris, 0.05% Tween,

pH 7.4) and then incubated with the primary antibody (II-1.1.1) in TBST/5% dry milk for

2 h at room temperature (or overnight at 4°C). After three washing steps with TBST for

10 min the blot was incubated with the horseradish peroxidase-conjugated secondary

antibody (II-1.1.2) in TBST/5% dry milk for 1 h at room temperature. Subsequently, the

membrane was washed three times with TBST and antibody-labeled proteins were

detected using SuperSignal West Pico chemiluminscence substrate (Pierce). Apparent

molecular weights were estimated from the migration rates of Precision Plus Protein

Standards (Bio-Rad). Blots shown are representative of at least three independent

experiments.

II-2.18 Statistics

The probability of significant differences between experimental groups was determined

by the Student’s t-test. Values are expressed as mean±S.E.M. of at least three

independent experiments unless stated otherwise.

Chapter 3

Proapoptotic Bcl-2 Family Members and Mitochondrial

Dysfunction during Ischemia/Reperfusion Injury in HL-1

Cardiac Myocytes

________________________________________________________________________

Adapted from: Brady N.R.1, Hamacher-Brady A.

1, and R.A. Gottlieb (2006). “Proapoptotic Bcl-2

family members and mitochondrial dysfunction during ischemia/reperfusion injury: a study

employing cardiac HL-1 cells and GFP-biosensors.” BBA - Bioenergetics, in press. 1Authors

contributed equally.

RESULTS: sI/R in HL-1 cells

III

45

The dynamics of Bax and Bid activation, in relation to mitochondrial dysfunction are

unclear in the context of I/R injury in the heart. The objective in this study was to

evaluate alterations to mitochondrial function in a cell-based model of myocardial

ischemia/reperfusion (I/R) injury. Using reporter dyes, GFP-biosensors and fluorescence

deconvolution microscopy we investigated mitochondrial function and morphology in

relation to Bax and Bid activation in the HL-1 cardiac cell line.

III-1 Simulated I/R in HL-1 cardiac myocytes induces mitochondrial

dysfunction and PCD

To simulate ischemia, which is characterized by a reduction in the supply of oxygen and

nutrients, resulting in lactate accumulation and intracellular acidosis, cells were bathed in

a hypoxic, glucose-free, lactate-containing acidic KH solution (pH 6.6) containing 2-

deoxyglucose to inhibit glycolysis (Maddaford et al., 1999). Following an ischemic

period of 2 h, reperfusion was initiated by exchanging the ischemic solution with

normoxic KH solution. Under control conditions, where cells were maintained in

normoxic KH solution for the duration of the experiment, cell viability was not

compromised. In response to sI/R, however, HL-1 cells reproducibly underwent cell

death over a time-course of several hours, as determined by plasma membrane

permeability to YoPro1 and propidium iodide (Bond et al., 1991; Idziorek et al., 1995)

(data not shown).

Mitochondrial dysfunction, characterized by the generation of ROS and loss of

∆Ψm, is a critical feature of I/R injury (Gottlieb, 2003; Levraut et al., 2003). Preservation

of mitochondrial integrity is essential for energy homeostasis and survival of the cardiac

myocyte, while compromised mitochondrial integrity ultimately leads to the conversion

of mitochondria into executers of PCD. We investigated whether our model of sI/R

activated classic parameters of mitochondrial dysfunction. 90 min after reperfusion, HL-

1 cells displayed decreased ∆Ψm, as indicated by decreased TMRM fluorescence, as well

as enhanced mitochondrial ROS generation, as indicated by increased mitochondrial-

concentrated CM-DCF fluorescence (Fig. 6). Notably, sI/R-activated ROS production

and ∆Ψm collapse occurred heterogeneously within the population of HL-1 cells. The

HL-1 cell line responds to 2 h simulated ischemia and 90 min reperfusion rather than the

RESULTS: sI/R in HL-1 cells

III

46

many hours of simulated ischemia required for neonatal myocytes or H9c2 cells. In this

respect, it more closely resembles adult cardiomyocytes which initiate similar responses

after 30 min simulated ischemia and 90 min reperfusion. The production of ROS and

mitochondrial depolarization also recapitulate well characterized events in myocardial

I/R injury.

TMRM (∆Ψ)

Control 90’ Reperfusion

CM-DCF (ROS)

Control 90’ Reperfusion

TMRM (∆Ψ)

Control 90’ Reperfusion

CM-DCF (ROS)

Control 90’ Reperfusion

FIG. 6. sI/R in HL-1 cardiac myocytes leads to mitochondrial dysfunction. HL-1 cells were

loaded with 10 µM CM-DCFH2-DA and subjected to 2 h ischemia in the presence of 5 nM TMRM. Following, reperfusion was introduced by a buffer exchange to dye-free KH solution. At 90 min of reperfusion, TMRM (upper panels) and CM-DCF (lower panels) fluorescence were compared to

normoxic control cells, which had been identically treated with dyes, to assess ∆Ψm and ROS levels, respectively. Representative images were acquired at 20x magnification under the exact same conditions to ensure comparability. Multicolor look up tables (LUT) were applied to grey scale images to visualize the range of fluorescence intensities with black representing lowest

pixel values and white representing highest pixel values. Scale bars, 50 µm.

III-2 Mitochondrial dysfunction and fragmentation

The modulation of mitochondrial morphology is an important parameter of mitochondrial

function. Recent studies have shown that during PCD induced by staurosporine

RESULTS: sI/R in HL-1 cells

III

47

(Karbowski et al., 2002), metabolic inhibition (Lyamzaev et al., 2004), or hydrogen

peroxide (Skulachev et al., 2004), fragmentation of the mitochondrial network is a

consistent feature.

Using mitochondrial-targeted fluorescent markers for mitochondria, either mito-

DsRed2 or mito-ECFP, we assessed mitochondrial morphology during sI/R-induced

injury using high resolution imaging. Prior to the ischemic insult, mito-DsRed2-labeled

mitochondria were observed as elongated, branched organelles, whereas mitochondrial

fragmentation occurred during ischemia and persisted during reperfusion (Fig. 7). Cells

incubated under control conditions (in KH solution) remained filamentous for more than

24 h (data not shown). These results indicate that a process of dramatic mitochondrial

remodeling is initiated during simulated ischemia.

Mito-DsRed2

Before sI/R

20’ ischemia

60’ reperfusion

FIG. 7. sI/R causes the disruption of the mitochondrial network. HL-1 cells were subjected to sI/R in the Leiden perfusion chamber mounted to the stage of the fluorescence microscope and mitochondrial dynamics were monitored by 4D-imaging of mito-DsRed2 with 20 min intervals between frames. During normoxic conditions prior to ischemia, mitochondria were branched and elongated (upper panel). sI/R induced fragmentation of the mitochondrial network (lower panels).

RESULTS: sI/R in HL-1 cells

III

48

III-2.1 sI/R-induced mitochondrial fragmentation is mediated by Drp1

To determine if mitochondrial fragmentation occurring during sI/R was due to specific

activity of known protein mediators of mitochondrial fission, and not an unspecific event,

cells were transiently transfected with vectors encoding either Drp1, which promotes

mitochondrial fission, or a GTPase-dead dominant negative of Drp1 (Drp1K38E

) which

blocks mitochondrial fission (Smirnova et al., 1998). Mitochondrial morphology was

examined using mito-DsRed2 as a mitochondrial marker (Fig. 8). Under control

conditions Drp1 increased the number of cells exhibiting the fragmented phenotype.

Drp1K38E

, as previously described, inhibited fragmentation, resulting in supra-networks

and perinuclear clustering (Smirnova et al., 1998).

Following ischemia, mitochondria of control and Drp1 overexpressing cells

underwent pronounced fragmentation. Fragmentation was significantly reduced by

expression of Drp1K38E

. Notably, fragmented mitochondria in Drp1 overexpressing cells

remained distributed throughout the cell, as opposed to control cells where mitochondrial

fragments clustered in perinuclear regions. Perinuclear clustering of mitochondria has

been described previously in PCD and attributed to activity of the mitochondrial fission

machinery, or impaired kinesin-dependent transport of mitochondria (Li et al., 1998;

Frieden et al., 2004).

III-3 Bax activation in sI/R One key feature of sI/R-induced cell death is the participation of the pro-apoptotic Bcl-2

protein Bax in the mitochondrial death pathway (Wolter et al., 1997). Under normal

conditions Bax is found homogeneously distributed throughout the cell. In neonatal

cardiac myocytes, Bax translocates to the mitochondria in response to staurosporine and

prolonged chemical hypoxia (Capano and Crompton, 2002).

RESULTS: sI/R in HL-1 cells

III

49

B

Representative images

Vector Drp1 Drp1K38R

KH

sI/R

(at

30

‘repf.

)

A

K38E

*

**

0

20

40

60

80

100

Vector Drp1 Drp1

% c

ells

with f

rag

mente

d

mitochondria

KH sI/R

FIG. 8. Drp1 mediates the disruption of the mitochondrial network. HL-1 cells were transfected with mito-DsRed2 to visualize mitochondrial morphology and incubated in KH solution or subjected to sI/R. At 30 min reperfusion, mitochondrial morphology was examined in live cells using a 60x lens. (A) Shown are maximum projections of representative images. During normoxic conditions prior to ischemia, mitochondria were branched and elongated. sI/R induced fragmentation of the mitochondrial network. Drp1 overexpression resulted in increased fragmentation of the mitochondrial network under control conditions (KH solution). Drp1

K38E

expression reduced sI/R activated mitochondrial fission. (B) Quantification of changes to mitochondrial morphology, as a function of Drp1, Drp1

K38E expression and sI/R (*p<0.001;

**p<0.05).

RESULTS: sI/R in HL-1 cells

III

50

III-3.1 Bax translocation and clustering

Using constructs encoding human Baxα fused to either EGFP (GFP-Bax (Wolter et al.,

1997) or monomeric red fluorescing mCherry (Shaner et al., 2004), (mCherry-Bax), we

investigated Bax translocation and clustering on mitochondria in response to sI/R. Under

normal conditions GFP-Bax was homogeneously distributed throughout the cytosol (Fig.

9). During the 2 h ischemic treatment, GFP-Bax detectably translocated in only a few

cells (~15%, data not shown). The majority of GFP-Bax translocation to the

mitochondria occurred during reperfusion. GFP-Bax initially circumscribed the outer

mitochondrial membrane and then, several hours into reperfusion, formed the typical

punctate GFP-Bax foci , or clusters (Nechushtan et al., 2001; Lim et al., 2002), at or on

fragmented mitochondria (Fig. 9).

sI/

RC

ontr

ol

Mito-DsRed2 GFP-Bax merge

FIG. 9. sI/R-induced Bax translocation to mitochondria. HL-1 cells were transfected with mito-DsRed2 to visualize mitochondria and GFP to follow changes in subcellular localization of Bax during sI/R. In normoxic control cells GFP-Bax exhibits diffuse cytosolic and nuclear fluorescence distributed equally throughout the cell (upper panels). Starting in ischemia and extending into the reperfusion period, Bax translocates to the mitochondria, where it coats them homogeneously (data not shown). By the time cells have completed 2 h ischemia and 5 h reperfusion, GFP-Bax is found as clusters surrounding individual swollen mitochondria (lower

panels). Scale bars, 10 µm. Identical results were obtained with mCherry-Bax.

RESULTS: sI/R in HL-1 cells

III

51

III-3.2 Bax translocation and clustering, mitochondrial fragmentation, and ∆∆∆∆ΨΨΨΨm

To further explore the two phases of Bax activation (translocation and clustering) we

transiently expressed a C-terminal threonine-to-alanine point mutant of Bax (T182A)

fused to mCherry (mCherry-BaxT182A

). BaxT182A

has been recently shown to

spontaneously translocate to mitochondria and in some cell types can trigger apoptosis

(Precht et al., 2005). The translocation of Bax to mitochondria is a prerequisite for

mitochondrial outer membrane permeabilization for cytochrome c release as well as for

the MPTP (Shimizu et al., 1999; Saito et al., 2000)

In HL-1 cells, the majority of mCherry-BaxT182A

was associated with the mitochondria

even under basal conditions (Fig. 10A). Interestingly, in the absence of sI/R, cells

transfected with either mCherry-Bax or mCherry-BaxT182A

exhibited polarized,

filamentous mitochondria, indicating intact mitochondrial function (Fig. 10B).

Moreover, for up to 4 days following transfection, BaxT182A

was not sufficient to induce

apoptosis in HL-1 cells. We therefore asked whether the mitochondrial localization of

Bax sensitized cells to sI/R injury. Bax-mCherry clustering was quantified at time points

2.5 h and 5 h of reperfusion. At 2.5 h of reperfusion, there was no statistically significant

difference between mCherry-Bax and mCherry-BaxT182A

clustering. However, at 5 h of

reperfusion, mCherry-BaxT182A

clustering was significantly higher than for mCherry-Bax

(Fig. 10C). These results indicate that in HL-1 cells Bax translocation itself is not

sufficient to induce mitochondrial fragmentation or depolarization, but that it may

sensitize the mitochondria to injury or shorten the interval to complete apoptosis. Thus,

Bax translocation may be regarded as a priming event. Bax clustering on the other hand

can be considered as an index of irreversible injury as it was followed by plasma

membrane permeabilization as determined by YoPro1 labeling (results not shown).

MAPK (mitogen-activated protein kinase) p38 is an established participant in I/R

activated PCD in the heart (Baines et al., 2005) Moreover, treatment with p38 inhibitors

can block nitric oxide-induced Bax activation (Ghatan et al., 2000). To determine the

effect of p38 on Bax translocation and clustering in our model of sI/R, we added the p38

inhibitor SB203580 at reperfusion. Inhibition of p38 significantly blunted mCherry-Bax

translocation and clustering. To determine if p38 was required just for translocation or if

it was also required for clustering, we evaluated the effect of SB203580 on mCherry-

RESULTS: sI/R in HL-1 cells

III

52

BaxT182A

(Fig. 10C). As previously observed, mCherry-BaxT182A

spontaneously

associated with mitochondria; however, the addition of SB203580 at reperfusion

prevented clustering. Taken together, these results indicate a role for p38 in both steps in

Bax activation.

In addition, we noted that while >90% of mitochondria were fragmented at the

end of ischemia, a morphology that persisted beyond 5 h reperfusion, cells treated with

SB203580 exhibited filamentous mitochondria at 5 h reperfusion, indicating that the

filamentous mitochondrial network had re-formed (Fig. 10D). This suggests that p38

may play an active role in regulating mitochondrial structure during I/R injury.

FIG. 10. Bax translocation to mitochondria independent of mitochondrial dysfunction. (A) Cells were co-transfected with mCherry-Bax constructs and mito-ECFP and cells were imaged in KH solution. Whereas mCherry-Bax(wt) was found to be homogeneously distributed throughout

the cell, mCherry-BaxT182A

was found to coat the mitochondrial networks of the cell. (B) ∆Ψm was determined using Rhodamine 123 (Rhod123, 50 nM). Cells expressing mCherry-Bax(wt) or mCherry-Bax

T182A exhibited similar levels of filamentous, polarized mitochondria. (C) Bax

mitochondrial localization and effect of p38 inhibition on Bax activation. At 2.5 h reperfusion the extent of clustering of mCherry-Bax

T182A was similar to mCherry-Bax(wt). At 5 h reperfusion

mCherry-BaxT138A

formed significantly more clusters than mCherry-Bax(wt) (p<0.01). SB203580

(10 µM) significantly decreased the percentage of cells with Bax clustering in both mCherry-Bax and mCherry-Bax

T182A expressing cells (p<0.01). (D) SB203580 effect on mitochondrial

morphology. At 5 h reperfusion, decreased mCherry-Bax(wt) and or mCherry-BaxT182A

clustering correlated with recovery of mitochondrial networks as revealed by imaging of mito-ECFP. mCherry-Bax(wt) was homogeneously distributed following SB203580 treatment at reperfusion.

*

***

RESULTS: sI/R in HL-1 cells

III

53

Mitochondrial depolarization occurred following fragmentation but prior to Bax

clustering. Mitochondrial depolarization is often a result of MPTP opening. To assess

whether Bax clustering caused or was a result of MPTP opening, we treated HL-1 cells

with CsA (1 µM). This intervention significantly reduced sI/R-induced GFP-Bax

clustering (Fig. 11), indicating that MPTP opening was upstream of Bax clustering.

0

10

20

30

40

50

60

70

Control CsA

% c

ells

with

pu

ncta

te G

FP

-Ba

x

KH sI/R

*

FIG. 11. MPTP is upstream of GFP-Bax activation. GFP-Bax expressing cells were subjected

to sI/R with or without 1 µM CsA. At 5 h of reperfusion, cells were classified as displaying diffuse cytosolic or punctate mitochondrial GFP-Bax localization. The percentage of cells with punctate

GFP-Bax distribution per total cells scored is represented as the mean±S.E.M. of three independent experiments, each performed in duplicate. CsA significantly reduced redistribution and clustering of GFP-Bax at the mitochondria (*p<0.05).

III-4 GFP-Bax clustering as a parameter of sI/R-induced injury

Using mitochondrial clustering of GFP-Bax as an index to monitor activation of PCD

(Fig. 12A) we found that sI/R induced PCD in a hypoxia/reoxygenation-dependent

manner (Fig. 12B).

RESULTS: sI/R in HL-1 cells

III

54

0

10

20

30

40

50

60

70

80

90

100

KH sI/R

Normox

sI/R

% c

ells

with

puncta

te G

FP

-Bax

A BNormoxic

sI/R (5h reperfusion)

*

FIG. 12. sI/R-specific GFP-Bax clustering. GFP-Bax transfected HL-1 cells were incubated in either KH solution or ischemia-mimetic solution for 2 h in normoxic (sI/R Normox) or hypoxic (sI/R) conditions followed by 5 h reperfusion in normoxic KH solution. (A) Z-stacks of

representative cells were acquired at 60x magnification with 0.3 µm increments. Shown are the maximum projections of total cellular GFP-Bax fluorescence. (B) Cells were then classified as displaying diffuse cytosolic or punctate mitochondrial GFP-Bax localization. Represented is the percentage of cells with punctate GFP-Bax distribution per total cells scored (*p<0.05).

Overexpression of both Bcl-2 and Bcl-xL, known protectors against cardiac I/R injury

(Brocheriou et al., 2000; Imahashi et al., 2004; Huang et al., 2005), significantly reduced

sI/R-induced GFP-Bax clustering, further demonstrating suitability of the experimental

model (Fig. 13A, B). Interestingly, both wild-type (WT-)Bcl-2 and mitochondrial-

targeted (mito-)Bcl-2 significantly protected against sI/R-induced GFP-Bax clustering,

while S/ER-targeted (S/ER-)Bcl-2 did not significantly affect GFP-Bax clustering (Fig.

13C).

RESULTS: sI/R in HL-1 cells

III

55

0

5

10

15

20

25

Vector WT-Bcl2 Mito-Bcl2 S/ER-Bcl2

% c

ells

with

pu

ncta

te G

FP

-Ba

x

KH sI/R

* **

0

10

20

30

40

50

60

70

Vector Bcl-2 Bcl-xL

% c

ells

with

pun

cta

te G

FP

-Ba

x

KH sI/RA B

* *

Actin

Bcl-x

L

Co

ntr

ol

Bcl-xL

Bcl-2

Co

ntr

ol

Actin

Bcl-2

C

Fig. 13. Anti-apoptotic Bcl-2 and Bcl-xL oppose sI/R-induced GFP-Bax clustering. (A) GFP-Bax transfected cells were co-transfected with Bcl-2 or Bcl-xL and overexpression of Bcl-2/-xL was verified by immunodetection of cell lysates. (B) GFP-Bax clustering was assessed under both control and sI/R conditions as under B (*p<0.05). (C) GFP-Bax clustering was assessed in control cells and cells co-expressing WT-Bcl-2, mito-Bcl-2, and S/ER-Bcl-2 (*p<0.01; **p<0.05).

RESULTS: sI/R in HL-1 cells

III

56

BBcl-xL

KH

sI/R

C

A

*

K38E

0

20

40

60

80

Vector Drp1 Drp1% c

ells

with p

uncta

teG

FP

-Bax

KH sI/R

0

20

40

60

80

100

Vector Bcl-xL

% c

ells

with

fra

gm

en

ted

m

ito

cho

nd

ria

KH sI/R

FIG. 14. Fissioned mitochondria afford protection from sI/R injury in HL-1 cells and Bcl-xL protects independently of mitochondrial fission. (A) HL-1 cells were co-transfected with GFP-Bax and either empty vector (control), Drp1, or Drp1

K38E. At 5 h following sI/R, GFP-Bax

activity (defined as punctate mitochondrial GFP-Bax localization) was quantified (*p<0.05). (B) Cells were co-transfected with mito-DsRed2 and Bcl-xL and subjected to sI/R. Shown are the maximum projections of representative cells under control (normoxic KH) or sI/R (at 30 min reperfusion) conditions. (C) Cells were co-transfected with GFP-Bax and empty vector or Bcl-xL and GFP-Bax clustering was quantified as described above.

RESULTS: sI/R in HL-1 cells

III

57

III-5 Drp1-mediated mitochondrial fragmentation protects against sI/R

We next determined the significance of mitochondrial morphological states (fragmented

vs. fused) in mediating the injury response to simulated I/R as determined via GFP-Bax

clustering. Drp1 significantly reduced sI/R-activated GFP-Bax clustering (Fig. 14A).

Drp1K38E

had no significant effect on GFP-Bax activity in response to sI/R. These results

indicate that ischemia-induced mitochondrial fission mediated by Drp-1 affords

protection from sI/R injury.

In order to understand the above results in the context of PCD, we then

overexpressed the anti-apoptotic protein Bcl-xL and examined the effect on mitochondrial

fragmentation. Bcl-xL, although protecting against GFP-Bax clustering (Fig. 13B), did

not block mitochondrial fragmentation (Fig. 14B, C), indicating that Bcl-xL does not

achieve mitochondrial protection through effects on mitochondrial fragmentation. We

infer that fragmentation precedes and is independent of mitochondrial pro-apoptotic

alterations.

III-6 Bid activation in sI/R monitored by a GFP biosensor

Bid is another pro-apoptotic Bcl-2 protein whose activation is thought to be a causative

event during myocardial I/R injury (Chen et al., 2002). To explore the kinetics of sI/R-

induced Bid activation in a time and spatially resolved manner, we constructed a GFP-

based biosensor, in which full-length Bid is flanked by YFP at the N-terminus and CFP at

the C-terminus (YFP-Bid-CFP). This was chosen in order to enable tracking of both the

N- and C-terminal fragments of Bid.

Under control conditions, both YFP and CFP fluorescence were distributed

homogeneously throughout the cell (Fig. 14A) consistent with the cytosolic distribution

of Bid in healthy cells. In cells which had been subjected to simulated ischemia followed

by prolonged hours of reperfusion (+6 h), however, YFP-Bid displayed mainly a diffuse

cytosolic staining pattern while C-terminal Bid-CFP (containing the BH3 domain) was

found at distinct subcellular regions (Fig. 15A). Dual imaging of mito-DsRed2 and tBid-

CFP identified mitochondria as the subcellular targets of Bid (Fig. 15B).

RESULTS: sI/R in HL-1 cells

III

58

A

B sI/R

Bid-CFP Mito-DsRed Merge

sI/R

Bid-CFP YFP-Bid Merge

Control

Bid-CFP YFP-Bid Merge

sI/R

Bid-CFP YFP-Bid Merge

Control

Bid-CFP YFP-Bid Merge

FIG. 15. YFP-Bid-CFP sensor to monitor Bid activation. (A) Cells were transfected with YFP-Bid-CFP and analyzed by 3D fluorescence imaging under control conditions and after 2 h ischemia and 6 h reperfusion. Under control conditions both CFP and YFP signals of Bid exhibit diffuse fluorescence. Following 6 h of reperfusion, Bid-CFP (C-terminal fragment) exhibits a punctate distribution resembling mitochondria, while YFP-Bid (N-terminal fragment) is diffusely distributed. (B) After sI/R, Bid-CFP co-localizes with mito-DsRed2 visually confirming the mitochondrial localization of activated tBid-CFP.

III-6.1 sI/R-induced cardiac myocyte Bid cleavage is mediated by caspase 8

Bid can be cleaved by various proteases such as caspase 8 (Li et al., 1998), calpain (Chen

et al., 2001; Mandic et al., 2002) cathepsin proteases (Stoka et al., 2001), and granzyme

B (Heibein et al., 2000; Sutton et al., 2000). While calpain has been reported to play a

role in I/R-induced Bid cleavage in the perfused whole heart model (Chen et al., 2001),

RESULTS: sI/R in HL-1 cells

III

59

Bid cleavage has been attributed to varying proteases depending on the death stimulus

and cell type (e.g., caspase 8 in cardiomyocytes vs. caspase 9 in endothelial cells in

response to sI/R the isolated heart (Scarabelli et al., 2002).

To determine whether caspase 8 was the responsible protease in sI/R-induced Bid

cleavage in HL-1 cells, we inserted a point mutation within the caspase 8 cleavage site of

Bid, generating Bid∆casp8, and subcloned it into the Bid biosensor. TNF-α activates

PCD involving caspase 8 dependent cleavage of Bid (Li et al., 1998). Treatment of HL-1

cells transfected with either Bid-sensor or Bid∆casp8-sensor with TNF-α resulted in the

cleavage of Bid-sensor but not Bid∆casp8-sensor, indicating successful mutation of the

caspase 8 cleavage site (Fig. 16A). Cells expressing the Bid∆casp8-sensor were

subjected to 2 h ischemia and 6 h reperfusion. The Bid∆casp8 cleavage product was not

detected although the cleavage product could be detected in cells expressing the wild type

Bid-sensor (Fig. 16A). Likewise, inhibition of caspases with 50 µM zVAD-fmk inhibited

sI/R-induced cleavage of ectopically expressed Bid-sensor as well as endogenous Bid,

while the presence of 10 µM ALLN, an inhibitor of calpain and cathepsins B and L, did

not affect Bid cleavage (Fig. 16B). These results indicate that caspase 8 is responsible for

Bid cleavage after sI/R of HL-1 cardiac myocytes.

Contr

ol

TN

F-α

Contr

ol

TN

F-α

sI/R

WT M WT M

sI/R

YFP-Bid-CFP

tBid-CFP

A sI/R

sI/R

+ A

LL

N

sI/R

+ z

VA

D-f

mk

tBid-CFP

Actin

FL-Bid

B

FIG. 16. Bid cleavage during sI/R is mediated by caspase 8. (A) HL-1 cells were transfected

with either Bid-sensor (WT) or Bid∆casp8-sensor (M) and treated with TNF-α (100 ng/ml) for 24 h. Proteins of whole cell lysates were separated by SDS-PAGE, transferred to nitrocellulose, and probed with anti-FP antibody to detect WT and M Bid-sensor (78 kDa) and cleavage product tBid-CFP (42 kDa). (B) Bid-sensor expressing cells were subjected to 2 h ischemia followed by 6 h

reperfusion in the presence of the protease inhibitors ALLN (10 µM) or zVAD-fmk (50 µM). Western blots of whole cell lysates were probed with anti-FP, anti-Bid, and anti-actin antibodies.

RESULTS: sI/R in HL-1 cells

III

60

A

B tBid-CFPmCherry-Bax

rendering

Control Control

mCherry-Bax Bid-CFP Merge

mCherry-Bax Bid-CFP Merge

sI/R

FIG. 17. Sequential activation of Bax and Bid in response to sI/R. (A) HL-1 cells were co-transfected with mCherry-Bax and YFP-Bid-CFP. CFP and mCherry signals were detected under control conditions (2+5 h KH solution) and after 2 h simulated ischemia and 5 h reperfusion. (B) To determine whether tBid and Bax colocalize at mitochondria, HL-1 cells transfected with Bid-sensor and mCherry-Bax were subjected to 2 h ischemia followed by 6 h reperfusion and analyzed by fluorescence microscopy. Z-stack was 3D-rendered using the VolumeJ plugin for ImageJ. 3D rendering reveals the distinct pattern of distribution of mCherry-Bax (clusters) and tBid-CFP (homogeneous mitochondrial pattern).

RESULTS: sI/R in HL-1 cells

III

61

III-7 Spatio-temporally resolved interplay of Bid and Bax at the

mitochondria

During the preceding experiments, we noted that Bid truncation and translocation to the

mitochondria occurred at a later time point than mitochondrial Bax translocation and

clustering. In order to resolve the spatio-temporal interplay of Bid and Bax at the

mitochondria, we transfected cells with both mCherry-Bax and YFP-Bid-CFP. Under

control conditions both mCherry-Bax and YFP-Bid-CFP were distributed homogeneously

throughout the cell. However, after 2 h ischemia and 5 h of reperfusion, mCherry-Bax

was detected at the mitochondria, mainly in the absence of YFP-Bid-CFP redistribution,

which could be detected more frequently at later times (Fig. 17A). These results are

consistent with the notion that Bax translocation and activation at the mitochondria

occurs prior to massive Bid activation. Although tBid is thought to function in concert

with Bax (Lim et al., 2002), we found that Bid did not localize to the Bax clusters but

instead displayed a homogeneous mitochondrial distribution (Fig. 17B).

Chapter 4

Bcl-2 Regulation of Sarco-/Endoplasmic Reticulum

Calcium Stores Mediates the Autophagic Response to

Nutrient Deprivation in HL-1 Cardiac Myocytes

________________________________________________________________________

Adapted from: Brady N.R., Hamacher-Brady A., and R.A. Gottlieb. “Bcl-2 regulation of

sarco/endoplasmic reticulum calcium stores mediates the autophagic response to nutrient

deprivation in the HL-1 cardiac myocyte.” Submitted.

RESULTS: Quantifying autophagic activity

IV

65

Recent findings evidence a link between the apoptotic and autophagic pathways through

the interaction of the anti-apoptotic proteins Bcl-2 and Bcl-xL with Beclin1 (Liang et al.,

1998; Saeki et al., 2000; Shimizu et al., 2004; Pattingre et al., 2005). However, the

nature of the interaction, either in promoting or blocking autophagy remains

controversial. In part this is due to incorrect use of tools available for detecting the

autophagic response: currently, a demonstration of increased presence of either

autophagic vacuoles (AVs) or protein markers thereof, is the standard means for

detecting changes in autophagic activity.

However, autophagy involves the delivery of the autophagosomes and their

contents to lysosomes which contain the degradative enzymes needed to complete the

catabolic processes of autophagy (Klionsky and Emr, 2000). Therefore, an increased

presence of AVs may either reflect (i) enhanced formation of AVs, (ii) impaired fusion of

AVs with lysosomes to generate autophagolysosomes, or (iii) a combination of both.

Moreover, the AVs may be removed by lysosomal degradation at a rate that exceeds our

imaging capabilities; i.e., the transit is so rapid and/or the AVs so small that only a few

AVs can be detected at any given time. Accordingly, a low number of AVs may be due

to either low or high autophagic activity.

Here we implement a highly-sensitive, macroautophagy-specific assay which

allows for the distinction between enhanced AV production and suppressed AV

degradation. Using this assay we investigated the control of Beclin1 and Bcl-2 on

nutrient deprivation-activated autophagy.

IV-1 Inhibiting lysosomal activity to quantify autophagic flux

During the initiation of autophagy, cytosolic LC3 (LC3-I) is cleaved and lipidated to

form LC3-II (Kabeya et al., 2004; Tanida et al., 2005). LC3-II is then recruited to the

autophagosomal membrane (Mizushima et al., 2001). Thus, punctate GFP-LC3-labeled

structures represent AVs. Importantly, overexpression of (GFP-)LC3 does not affect

autophagic activity, and transgenic mice expressing GFP-LC3 display no detectable

abnormalities (Kirisako et al., 1999; Mizushima et al., 2004).

In this study we utilized the extent of GFP-LC3-labeled AV formation during a

set amount of time as a specific index of macroautophagic activity. Lysosomal

RESULTS: Quantifying autophagic activity

IV

66

degradation of AVs was blocked using a cocktail consisting of the cell-permeable

pepstatin A methyl ester (5 µg/µl, inhibitor of cathepsin D), (2S,3S)-trans-epoxysuccinyl-

L-leucylamido-3-methylbutane ethyl ester (E64d; 5 µg/µl, inhibitor of cathepsin B) and

bafilomycin A1 (Baf A1, 50 µM; inhibitor of v-ATPase). To verify the inhibition of

cathepsin activity we utilized the fluorescent MagicRed Cathepsin B substrate

(Lamparska-Przybysz et al., 2005). Under normal conditions MagicRed fluorescence is

localized to individual organelles representing the lysosomes due to processing of the

substrate to its fluorescent form by the lysosomal protease cathepsin B (Fig. 18A). In

cells treated with the inhibitor cocktail, fluorescence intensity was decreased due to

decreased MagicRed processing by cathepsin B. Similarly, lysosomal acidification

which is required for protease activity (Yoshimori et al., 1991) and AV-lysosome fusion

(Yamamoto et al., 1998), was inhibited as assayed by LysoTracker Red (Fig. 18B).

Ma

gic

Red

LT

R

KH KH + i

KH KH + Baf A1

A

B

FIG. 18. Inhibition of lysosomal activity with the inhibitor cocktail. (A) Inhibition of cathepsin B activity by lysosomal inhibitors. Activity and intracellular distribution of cathepsin B, a predominant lysosomal protease, was assessed using MagicRed-Cathepsin B substrate. HL-1 cells were treated with lysosomal inhibitors (Baf A1, pepstatin A methyl ester, and e64D) for 2 h with MagicRed present during the last 30 min of the experiment. (B) Inhibition of v-ATPase activity by Baf A1. Following 2 h incubation in KH + Baf A1, cells were loaded with 50 nM LysoTracker Red (LTR) for 5 min. The solution was then exchanged with dye-free KH solution, and cells were analyzed by fluorescence microscopy. (A+B) Shown are the maximum projections of deconvolved Z-stacks of representative cells acquired at 40x magnification.

RESULTS: Quantifying autophagic activity

IV

67

IV-2 Quantifying autophagy in HL-1 cardiac myocytes

We first characterized the basal level of autophagy in fully supplemented medium

(Claycomb et al., 1998). GFP-LC3 expressing HL-1 cells were treated with the

lysosomal inhibitor cocktail for a period of 3.5 h and the percentage of cells

demonstrating a robust intracellular accumulation of GFP-LC3-labeled AVs (active

autophagy) was determined by fluorescence imaging. Two populations were readily

apparent: under full medium conditions in the absence of the inhibitor cocktail the

majority of the cells contained few or no AVs (Fig. 19A). In the presence of lysosomal

inhibitors, only a small, statistically insignificant increase in the percentage of cells

exhibiting high AV content was observed, evidencing low autophagic activity under high

nutrient conditions. The results, represented as bar graphs, thus indicate the percentage of

cells showing numerous AVs at steady-state (absence of inhibitors; representing either

increased AV formation or slow degradation) and under inhibited degradation of AVs

(cumulative AV formation over a fixed period of time). The difference in cells with high

AV content in the presence or absence of inhibitors (number in graphs) represents the

percentage of cells with high autophagic flux (Fig. 19B).

IV-2.1 Pharmacologic activation of autophagy

We next sought to gauge the accuracy of our method to determine autophagic flux by

evaluating the effect of agents known to perturb the autophagic pathway. Rapamycin can

stimulate autophagy even under high nutrient conditions (Noda and Ohsumi, 1998).

GFP-LC3-expressing HL-1 cells were treated with the lysosomal inhibitor cocktail in full

medium, without and with rapamycin. In the absence of lysosomal inhibitors, the

percentage of cells with high AV content increased only slightly in response to

rapamycin (Fig. 19A). Lysosomal inhibition in rapamycin-treated cells, however,

resulted in a profound further increase in the percentage of cells with high AV content,

revealing the autophagy-inducing potential of rapamycin (Fig. 19B). Furthermore, our

results demonstrate that the rapamycin-induced AV formation in full medium exceeds the

capacity for AV degradation, as steady-state levels of AVs increased even though flux

greatly increased.

RESULTS: Quantifying autophagic activity

IV

68

A FM FM + RmC

um

ula

tive

AV

sS

tead

y-s

tate

AV

s

B

0

20

40

60

80

100

Control Rm

% c

ells

with

nu

me

rou

s G

FP

-LC

3

va

cuo

les

Steady-state AVs

Cumulative AVs

*

**

9.3

42.3 ***

FIG. 19. Basal and rapamycin-activated autophagic activity in full medium. (A) GFP-LC3 transfected HL-1 cells were treated with 1 µM rapamycin for 30 min in full medium (FM). Z-stacks of representative cells were acquired at 60x magnification and subsequently processed by 3D blind deconvolution (AutoQuant). Shown are the maximum projections of total cellular GFP-LC3 fluorescence. (B) The percentage of cells with high numbers of AVs without (steady-state AVs) and with (cumulative AVs) lysosomal inhibitors was quantified (*p<0.05; **p<0.01; ***p<0.001).

IV-2.2 Autophagic response to nutrient deprivation

Autophagy is strongly upregulated in response to nutrient deprivation (Kim and

Klionsky, 2000). GFP-LC3-expressing HL-1 cells were incubated in glucose-containing

RESULTS: Quantifying autophagic activity

IV

69

Krebs-Henseleit (KH) solution, which deprives the cells of amino acids and serum,

without and with the lysosomal inhibitors (Fig. 20A, B). Similar to the results in full

medium, low steady-state levels of AVs were detected in KH alone, yet lysosomal

inhibition revealed robust levels of autophagic flux in almost all cells, with ~90% of cells

displaying high AV levels. A remainder of ~10% was inhibitor-insensitive. These

results indicate that, as expected, autophagic flux was substantially upregulated in

response to a low nutrient environment.

KH KH + i

0

20

40

60

80

100

120

KH

% c

ells

with n

um

ero

us G

FP

-LC

3

vacuo

les

Steady-state AVs

Cumulative AVs

A

B

FIG. 20. Autophagic flux under nutrient deprivation. (A) Shown are maximum projections of Z-stacks taken of GFP-LC3 fluorescence in cells incubated in KH for 2 h without and with lysosomal inhibitor cocktail. Without lysosomal inhibition cells typically displayed low steady-state AV contents (left panel). However, in the presence of the inhibitor cocktail cells accumulated numerous AVs revealing high autophagic flux (right panel). (B) The percentage of cells with high numbers of AVs without (steady-state AVs) and with (cumulative AVs) lysosomal inhibitors was quantified (*p<0.001).

RESULTS: Quantifying autophagic activity

IV

70

IV-2.3 Molecular perturbation of the autophagic pathway

During formation of the pre-autophagosomal structure, the C-terminal glycine of Atg12

forms a bond with Atg5 lysine 130. Replacing Atg5 lysine 130 with arginine (Atg5K130R

)

renders Atg5 unable to accept Atg12, and thus blocks AV formation, including LC3

recruitment (Mizushima et al., 2001). In order to enable molecular perturbation of the

autophagic pathway, we generated and characterized fusion proteins of the monomeric

red fluorescent protein mCherry (Shaner et al., 2004) and Atg5 or the dominant negative

mutant of Atg5, Atg5K130R

. Autophagic flux was determined under full medium and KH

solution conditions in HL-1 cells co-transfected with GFP-LC3 and either mCherry,

mCherry-Atg5 or mCherry-Atg5K130R

(Fig. 21A). Expression of mCherry-Atg5 did not

significantly influence autophagic flux in either high or low nutrient conditions when

compared to control (mCherry-expressing) cells. However, expression of mCherry-

Atg5K130R

significantly reduced both steady-state and lysosomal inhibitor-sensitive

accumulation of AVs in low nutrient conditions. This trend, although insignificant, was

also observed under high nutrient conditions. Moreover, high resolution imaging

indicated that AV formation was interrupted by mCherry-AtgK130R

(Fig. 21B). In

response to nutrient starvation, GFP-LC3-labeled punctae were smaller in mCherry-

AtgK130R

cells than in control or mCherry-Atg5 cells, indicative of failed pre-

autophagosome maturation (Mizushima et al., 2001).

RESULTS: Quantifying autophagic activity

IV

71

0

20

40

60

80

100

Vector Atg5 Atg5 Vector Atg5 Atg5

% c

ells

with n

um

ero

us G

FP

-LC

3

vacuo

les

Steady-state AVs Cumulative AVs

K130R K130R

FM KH

**

14.218.4

8.3

81.072.5

34.9

*

A

B

FIG. 21. Atg5 control of autophagosome formation. HL-1 cells were co-transfected with GFP-LC3 and either mCherry (empty vector control), mCherry-Atg5 or mCherry-Atg5

K130R. Cells were

incubated in KH solution, with or without lysosomal inhibitors for 3.5 h, at which time the cells were formaldehyde-fixed. (A) Autophagic flux was quantified via scoring of mCherry-positive cells with numerous GFP-LC3 vacuoles without (steady-state AVs) and with (cumulative AVs) lysosomal inhibitors. Represented is the percentage of cells with numerous GFP-LC3 vacuoles per total cells scored (*p<0.05; **p<0.001 (flux: Vector vs. Atg5

K130R in KH)). (B) Representative

images of the autophagic response are shown.

RESULTS: Quantifying autophagic activity

IV

72

Together, these results demonstrate that, contrary to current assumptions,

autophagic activity and AV content are not necessarily correlated, either positively or

negatively. Low levels of autophagy (full medium), high levels of autophagy (nutrient

deprivation) and impaired autophagy (mCherry-Atg5K130R

), are all reflected in low

steady-state presence of GFP-LC3-labeled AVs. However, the use of lysosomal

inhibitors revealed substantial differences in actual autophagic flux and thus is necessary

in order to quantify autophagic activity.

Interestingly, the maximal percentage of cells responding to nutrient deprivation

or rapamycin was ~90%, indicating that ~10% of cells lack the capacity for AV

generation. Similarly, ~10% of cells displayed high steady-state levels of AVs. AV

presence in this subpopulation may indicate disrupted autophagic flux. Therefore, ~80%

of HL-1 cells have the capacity to mount an autophagic response.

IV-2.4 Beclin1 control of the autophagic response to nutrient deprivation is dependent on a functional Bcl-2/-xL binding domain

Having established a novel sensitive method to quantify the autophagic response in a

population of cells, in response to both acute activation (rapamycin) and genetic

disruption (Atg5K130R

), we investigated the control of Beclin1 and its binding partners,

Bcl-2, on autophagic activity.

Beclin1 was the first mammalian protein described to mediate autophagy (Liang

et al., 1999). Beclin1 interacts with the class III PI3-K Vps34, regulating the formation

of the lipid second messenger phosphatidylinositol 3-phosphate (PI3-P) which is required

for activating the autophagic pathway (Kihara et al., 2001). Beclin1 contains a Bcl-2-

binding domain which has been shown to interact with anti-apoptotic Bcl-2 and Bcl-xL,

but not pro-apoptotic Bcl-2 family members (Liang et al., 1998). However, the nature of

the relationship between Beclin1 and Bcl-2 remains unclear. Recent work has implicated

Bcl-2 in the suppression of starvation-induced autophagy (Pattingre et al., 2005), yet

others have shown that Bcl-2 positively regulates autophagic cell death activated by

etoposide (Shimizu et al., 2004).

Here we sought to determine the effect of Beclin1 and a mutant form of Beclin1

lacking the Bcl-2 binding domain (Beclin1∆Bcl2BD) on autophagic activity, under high

RESULTS: Quantifying autophagic activity

IV

73

and low nutrient conditions. Under high nutrient conditions, steady-state and cumulative

autophagy were similar in control cells and Beclin1-transfected cells (Fig. 22A). In KH

solution, both control and Beclin1-overexpressing cell populations responded maximally

to nutrient deprivation. Beclin1∆Bcl2BD expression significantly reduced the percentage

of cells with autophagic flux in low nutrient conditions, indicating that Beclin1-mediated

autophagy required the presence of Bcl-2/-xL for maximal autophagic response.

Consistent with a failed response to trigger AV formation, Beclin1∆Bcl2BD expression

resulted in the formation of small GFP-LC3 ‘speckles’, similar to that observed in cells

expressing Atg5K130R

(Fig. 22B).

IV-3 Bcl-2 suppression of the autophagic response to nutrient deprivation

is dependent on its subcellular localization

Our ability to quantify autophagic flux (versus the commonly reported AV content)

revealed the surprising finding that Beclin1∆Bcl2BD suppressed autophagy.

Beclin1∆Bcl2BD, as well as other Beclin1 mutants lacking Bcl-2 interaction, increased

steady-state AV levels in cancer cells and have been shown to activate cell death during

nutrient deprivation, presumably due to overactive autophagy. Furthermore, Bcl-2 was

found to suppress steady-state AV levels presumably through its interaction with the

Beclin1 Bcl-2 binding domain (Pattingre et al., 2005).

To unravel the reasons for this discrepancy, we investigated the effect of Bcl-2

overexpression on the autophagic response to nutrient deprivation (Fig. 23). Although

we found that Beclin1∆Bcl2BD expression greatly reduced the autophagic response, we

detected a minor but statistically significant suppressive effect on autophagy by

overexpression of wild-type (WT-) Bcl-2. Endogenous Bcl-2 is found in the cytosol, at

the mitochondria, and at the S/ER (Lithgow et al., 1994). Forced localization of Bcl-2 to

the S/ER was shown to be responsible for the suppression of AV formation in response

to nutrient deprivation (Pattingre et al., 2005). We found that similar to the findings with

WT-Bcl-2, mitochondrial- (mito-)targeted Bcl-2 only slightly suppressed the autophagic

response. However, S/ER-targeted Bcl-2 potently decreased the percentage of cells

exhibiting autophagic activity in response to nutrient deprivation by about ~50%.

RESULTS: Quantifying autophagic activity

IV

74

0

20

40

60

80

100

Vector Beclin1 Beclin1∆Bcl2BD

Vector Beclin1

% c

ells

with

nu

me

rou

s G

FP

-LC

3

vacuo

les

Steady-state AVs Cumulative AVs

Beclin1∆Bcl2BD

FM KH

*

15.7

10.4

5.6

80.378.2

42.9

Vector Beclin1 Beclin1∆Bcl2-BD

A

B

KH

+ i

FIG. 22. Beclin1 regulation of the autophagic response. HL-1 cells co-transfected with GFP-LC3 and either a plasmid encoding Beclin1, Beclin1∆Bcl2BD or empty vector (control). Cells were incubated in either the high-nutrient full medium (FM) or low nutrient KH solution. Cells were incubated either without or with the lysosomal inhibitor cocktail for 3.5 h and formaldehyde-fixed. (A) Autophagic flux was determined via fluorescent imaging of GFP-LC3-II without (steady-state AVs) and with (cumulative AVs) lysosomal inhibitors. Represented is the percentage of cells with numerous GFP-LC3 vacuoles per total cells scored (*p<0.01 (flux: Vector vs. Beclin1 ∆Bcl2BD)). (B) Maximum projections of Z-stacks of representative cells in each condition are shown.

RESULTS: Quantifying autophagic activity

IV

75

0

20

40

60

80

100

Vector WT-Bcl2 Mito-Bcl2 S/ER-Bcl2

% c

ells

with

num

ero

us G

FP

-LC

3

va

cu

ole

s

Steady-state AVs Cumulative AVs

**78.5

67.9 73.5

38.2

* *

FIG. 23. Bcl-2 control of autophagic activity. HL-1 cells were transfected with GFP-LC3 and either empty vector, mito-Bcl-2, wild type Bcl-2, or S/ER-Bcl-2 constructs. Cells were incubated for 3.5 h in KH solution, without and with lysosomal inhibitors, at which time they were fixed by formaldehyde (4%). The percentage of cells displaying high levels of AVs was quantified under all conditions (*p<0.05; **p<0.001 (cumulative AVs vs. Vector)).

IV-4 Bcl-2 overexpression inhibits autophagy due to depletion of

sequestered S/ER Ca2+ stores

The strong suppressive effect on autophagy exerted by Beclin1∆Bcl2BD, the minimal

suppressive effect of wild-type Bcl-2, together with the profound suppressive effect of

S/ER-targeted Bcl-2 were not compatible with Bcl-2 functioning simply as a direct

suppressor of Beclin1 activity. These conflicting results suggested the presence of an

additional mechanism controlling autophagic activity. At the S/ER, Bcl-2 is involved in

the regulation of Ca2+

homeostasis. Bcl-2 increases the permeability of the S/ER to Ca2+

(Foyouzi-Youssefi et al., 2000) through its interaction with sarco/endoplasmic reticulum

Ca2+

ATPase (SERCA), which is responsible for pumping Ca2+

from the cytosol back

into the S/ER (Dremina et al., 2004). Intriguingly, S/ER Ca2+

stores are required for the

activation of autophagy (Gordon et al., 1993) as well as downstream lysosomal function

(Hoyer-Hansen et al., 2005). We hypothesized that Bcl-2 targeted to the S/ER inhibits

autophagy in part due to modulation of the S/ER Ca2+

content.

RESULTS: Quantifying autophagic activity

IV

76

We first sought to determine whether overexpression of Bcl-2 significantly

reduced Ca2+

content in the HL-1 cardiac cell. S/ER Ca2+

homeostasis is maintained by a

concerted action of release by ryanodine receptor and re-uptake by SERCA.

Thapsigargin (TG), a selective SERCA inhibitor (Thastrup et al., 1990), can be used to

deplete S/ER Ca2+

stores, by blocking re-uptake (Thastrup et al., 1990). S/ER Ca2+

content was inferred by measuring the increase in cytosolic Ca2+

after TG treatment using

fluorescent Ca2+

indicator Fluo-4 (Fig. 24A, B). TG-mediated depletion of S/ER Ca2+

was similar between WT-Bcl-2 and control cells, but was significantly reduced in cells

expressing S/ER-Bcl-2. These results demonstrate that the capacity for S/ER Ca2+

release, an index of S/ER Ca2+

levels, is reduced by S/ER-Bcl-2 in the HL-1 cardiac

myocyte.

-20

-10

0

10

20

30

40

Vector WT-Bcl-2 Mito-Bcl-2 ER-Bcl-2

% T

G-in

duced

ch

ang

e in F

luo-4

fluore

scence

A B

S/

+ TGFluo-4

Vector

WT

S/ER

*

**

FIG. 24. Bcl-2 reduces S/ER Ca2+

content. HL-1 cells were co-transfected with mito-CFP and either WT-Bcl-2 or S/ER-Bcl-2. Cells were incubated with 2 µM Fluo-4 and solution was replaced with dye-free KH solution, containing norepinephrine (100 µM) to stimulate Ca

2+ release. 10

images were collected prior to the addition of 1 µM thapsigargin (TG), at 1 image/sec. (A) Representative images. (B) The average percent change in Fluo-4 fluorescence was calculated (*p<0.01; **p<0.001).

IV-5 Positive regulation of autophagy by S/ER Ca2+

Consistent with previous reports (Dremina et al., 2004; Palmer et al., 2004), we found

that in HL-1 cardiac myocytes, S/ER-targeted Bcl-2 depleted Ca2+

content in the S/ER.

RESULTS: Quantifying autophagic activity

IV

77

We then sought to determine whether low levels of intracellular Ca2+

influence the

activation of autophagy by nutrient deprivation. BAPTA-AM (25 µM), a membrane

permeable Ca2+

chelator (Tsien, 1980), was applied to HL-1 cells, and autophagic flux

was quantified. BAPTA-AM treatment resulted in complete inhibition of autophagic

activity (Fig. 25A). Moreover, BAPTA-AM decreased autophagy in the presence of

rapamycin (1 µM; results not shown).

To determine whether S/ER Ca2+

content affected autophagic activity, we

depleted S/ER Ca2+

with TG. In control, WT-Bcl-2, mito-Bcl-2, and S/ER-Bcl-2 cells,

TG (1 µM) significantly suppressed nutrient deprivation-induced autophagic activity by

70-80%. Furthermore, in cells expressing S/ER-Bcl-2, TG reduced autophagic activity to

zero (cumulative AVs + TG equaled S/ER-Bcl-2 steady-state AVs) (Fig. 25B).

0

20

40

60

80

100

KH Control KH + BAPTA

% c

ells

with

num

ero

us G

FP

-LC

3

va

cu

ole

s

Steady-state AVs

Cumulative AVs

75.1

5.1

*

A

0

20

40

60

80

100

Vector WT-Bcl2 Mito-Bcl2 S/ER-Bcl2

% c

ells

with n

um

ero

us G

FP

-LC

3

vacuole

s

Cumulative AVs Cumulative AVs + TG

** *

*

B

FIG. 25. Role of S/ER Ca

2+ stores on nutrient deprivation induced autophagy. HL-1 cells

were transfected with GFP-LC3. Cells were incubated in the absence or presence of either (A) BAPTA-AM (25 µM) or (B) TG (1 µM) for 3.5 h in KH solution, without or with lysosomal inhibitors, at which time they were fixed with formaldehyde (4%). The percentage of cells displaying high levels of AVs was quantified ((A) *p<0.01; (B) *p<0.001 (vs. respective cumulative AVs w/o TG)). .

Chapter 5

Enhancing Macroautophagy Protects Against

Ischemia/Reperfusion Injury in HL-1 Cardiac Myocytes

________________________________________________________________________

Adapted from: Hamacher-Brady A, Brady NR, and Gottlieb RA. “Enhancing macroautophagy

protects against ischemia/reperfusion injury in cardiac myocytes.” Submitted.

RESULTS: Autophagy protects against sI/R

V

81

Cardiac myocytes undergo PCD as a I/R, resulting in reduced heart function. One feature

of I/R injury is the increased prevalence of autophagosomes. However, to date it is not

known whether autophagy functions as a protective pathway, contributes to PCD, or is a

non-relevant event during myocardial I/R injury. Autophagy may be a protective

response to I/R injury, as increased presence of autophagosomes has been documented in

response to sub-lethal ischemia in the perfused heart (Decker and Wildenthal, 1980).

Moreover, it was recently reported that enhanced levels of Beclin1 in the heart correlated

with the onset of protection in an in vivo model of myocardial stunning (Yan et al.,

2005).

V-1 Cellular autophagosomal content is increased during the early phase

of sI/R injury

We used HL-1 cells to explore the role of autophagy during sI/R injury. To determine if

autophagic activity is modulated in response to sI/R, we first characterized changes in

cellular autophagosomal content using high-resolution 3D-imaging of GFP-LC3. We

transfected HL-1 cardiac myocytes with GFP-LC3 and compared the abundance of AVs

in cells subjected to sI/R to normoxic control cells. Under normoxic conditions in KH

solution, GFP-LC3 was diffusely distributed throughout the cell, with very few detectable

AVs (Fig. 26A, upper panel). Cells subjected to sI/R, however, displayed increased

numbers of AVs (Fig. 26A, bottom panel). In addition, in control cells the few pre-

existing AVs were randomly distributed, while AVs in cells subjected to sI/R were

typically more clustered at the center of the cell. This distinctive distribution contrasts

with the autophagic response to starvation in hepatocytes, where no such clustering was

observed (Kochl et al., 2006).

To quantify the increase in GFP-LC3-labeled AVs, the percentage of cells

displaying numerous punctate GFP-LC3 structures was determined. Only a small

fraction of cells displayed punctate GFP-LC3 fluorescence when incubated in fully

supplemented medium or KH solution (Fig. 26B). In cells subjected to sI/R, however, the

number of cells with numerous AVs was significantly increased (Fig. 26B). Quantitative

analysis performed on Z-stacks of GFP-LC3 fluorescence revealed that sI/R significantly

RESULTS: Autophagy protects against sI/R

V

82

increased the number of AVs per cell and, likewise, the total autophagosomal volume

(Fig. 26C).

0

5

10

15

20

25

30

Normoxic sI/R

AV

vo

lum

e p

er

ce

ll [u

m2

]

0

5

10

15

20

25

30

Normoxic sI/R

Nu

mb

er

of A

Vs p

er

ce

ll

0

10

20

30

40

50

60

70

80

90

100

FM KH sI/R

% c

ells

with G

FP

-LC

3 v

acu

ole

s

A B

C *

*

*

(1.5h reperfusion)

Autophagosomalvolume/cell XY

XZ

ZYXY

XZ

ZY

XY

XZ

ZYXY

XZ

ZY

Normoxic

sI/R

Autophagosomalvolume/cell XY

XZ

ZYXY

XZ

ZY

XY

XZ

ZYXY

XZ

ZY

Normoxic

sI/R

FIG. 26. Analysis of cellular autophagosomal content during sI/R. GFP-LC3 expressing cells were subjected to 2 h ischemia and 1.5 h reperfusion. The extent of autophagy was assessed by the intracellular distribution of GFP-LC3. (A) Z-stacks of representative cells were acquired at

60x magnification with 0.3 µm increments to capture the total autophagosomal population of a cell. Shown are the maximum projections of total cellular GFP-LC3 fluorescence in the XY, XZ and YZ planes. (B) Cellular AV content in a population of cells was quantified and represented as the percentage of cells with numerous GFP-LC3 vacuoles at 1.5 h reperfusion (*p<0.05). FM, full medium. (C) Quantification of intracellular autophagy of single cells was performed via 3D analysis of representative Z-stacks. Shown are the average number of autophagosomes per cell (left panel) and the average autophagosomal volume per cell (right panel). sI/R significantly increased levels of autophagy in single cells (*p<0.01).

RESULTS: Autophagy protects against sI/R

V

83

V-2 Changes in autophagic activity during ischemia an reperfusion

We subsequently addressed the effect of sI/R on actual autophagic activity. Our results

above (V-1) demonstrate that cellular AV content was increased early in the reperfusion

period. However, a central finding of Chapter II was that steady-state levels of AVs do

not reflect autophagic flux. Thus, the increased presence of AVs observed during sI/R

may either be a sign of (i) enhanced formation of AVs, (ii) impaired fusion of AVs with

lysosomes to generate autophagolysosomes, or (iii) a combination of both. To

characterize autophagic activity in sI/R we therefore determined two relevant parameters

of autophagosome-lysosome fusion: the index of LC3-II degradation (autophagic flux)

and downstream lysosomal activity.

V-2.1 Flux of LC3-II degradation during sI/R

Using our previously established (Chapter II) approach based on the inhibition of

downstream lysosomal degradation of AVs and their cargo, we determined whether the

increase in cellular AVs during sI/R was indicative of increased or impaired autophagy.

Cells were subjected to various experimental conditions and treated with a cocktail of

lysosomal inhibitors to inhibit autophagolysosome formation (with bafilomycin A1) and

lysosomal protease activity (with E64D and pepstatin A). By analyzing the lysosomal

inhibitor-mediated increase in GFP-LC3-II (AV) accumulation within a cell population

we were able to obtain a quantitative index of the flux of AV formation and degradation.

Bar graphs depict the percentage of cells exhibiting high AV levels in the absence and

presence of lysosomal inhibitors, per condition. The difference between the two bars (see

values in graphs) is a measure of the percentage of cells demonstrating high autophagic

activity, or flux.

As reported in Chapter IV, in KH solution AV content was dramatically increased

in the presence of inhibitors (IV-2.2). Thus, under control conditions in KH solution,

which lacks the serum and amino acid component of full medium, autophagy was

strongly active. sI/R augmented the number of cells with increased numbers of AVs (Fig.

27A). Under lysosomal inhibition the number of cells with high AV content was

increased only slightly more, indicating that the previously described steady-state

increase in cellular AV content in sI/R (Fig. 26 and 27A) is a reflection of an

accumulation of AVs, presumably due to impairment in the autophagic pathway at a

RESULTS: Autophagy protects against sI/R

V

84

point(s) following AV formation and before AV degradation. As the level of AV

accumulation was substantially smaller than the inhibitor-mediated response seen in KH

solution for the same period of time, it can be concluded that autophagy is also impaired

at the level of AV formation.

A

0

20

40

60

80

100

KH sI/R sI/R Normox

% c

ells

with

nu

me

rou

s G

FP

-LC

3

vacu

ole

s

Steady-state AVs Cumulative AVs

**

*63.3

12.4

56.1

B

*

**

0

20

40

60

80

100

KH ISCH ISCH Normox

% c

ells

with

nu

me

rou

s G

FP

-LC

3

vacu

ole

s

Steady-state AVs Cumulative AVs

74.11.8

39.1

FIG. 27. Flux of LC3-II degradation during sI/R. (A) Inhibitor-sensitive autophagy at 1.5 h reperfusion was quantified by determining the percentage of cells with numerous GFP-LC3-labeled AVs in each condition without (steady-state AVs) and with (cumulative AVs) lysosomal inhibitors present during reperfusion (cumulative AVs: *p<0.001 (KH vs. ISCH); **p<0.01 (KH vs. ISCH Normox)). sI/R ‘Normox’, ischemia-mimetic solution in presence of oxygen. (B) GFP-LC3-expressing cells were fixed immediately following 2 h ischemia without and with presence of lysosomal inhibitors and autophagic flux was determined as described above (*p<0.01, steady-state AVs (KH vs. sI/R); **p<0.05, cumulative AVs (KH vs. sI/R)). Lysosomal inhibitors were present throughout ischemia. ISCH, ischemia; ISCH ‘normoxic’, ischemia-mimetic solution in presence of oxygen.

Most AVs were formed during the reperfusion period, as cells fixed immediately

after the ischemic period were essentially devoid of AVs, either with or without

RESULTS: Autophagy protects against sI/R

V

85

lysosomal inhibitors, indicating a complete blockage of autophagy during the ischemic

period (Fig. 27B). Interestingly, hypoxia was a necessary component of the insult, as

cells incubated in ischemia-mimetic solution alone, under normoxic conditions, exhibited

only a minor reduction of autophagic flux which recovered completely upon reperfusion

(Fig. 27A).

V-2.2 Lysosomal activity during sI/R

One possible explanation for the observed accumulation of AVs during sI/R was a non-

functional lysosomal compartment. To investigate downstream lysosomal activity, HL-1

cells were incubated in LysoTracker Red (LTR), which labels the highly acidic lysosomal

vacuoles and thus reports activity of the vacuolar H+-ATPase (v-ATPase). Before and

after sI/R, we observed similar patterns of LTR fluorescence, indicating that, consistent

with its importance in cell survival during I/R (Karwatowska-Prokopczuk et al., 1998),

activity of the v-ATPase is maintained during the reperfusion period (Fig. 28A).

Furthermore, we determined the activity and subcellular localization of cathepsin

B, a predominant lysosomal protease, using a MagicRed substrate which fluoresces when

cleaved by cathepsin B (Lamparska-Przybysz et al., 2005). We did not detect a decrease

in cathepsin B activity following sI/R, as MagicRed fluorescence was still punctate

(lysosomal) and displayed an intensity comparable to the normoxic control (Fig. 28B).

Moreover, we found that cathepsin B activity was not detected in the cytosol, indicating

that cathepsin B is not released from the lysosomes following sI/R. Together, these

results indicate a functional lysosomal compartment during our experiments.

FIG. 28. (Next page) Assessment of lysosomal activity and participation in pro-death signaling. Representative images were aquired at 40x magnification under the exact same conditions to ensure comparability. Multicolour look-up-tables were applied to grey scale images to visualize the range of fluorescence intensities with black representing lowest pixel values and white representing highest pixel values. (A) Cells were subjected to the experimental conditions and then stained with 50 nM LTR. Shown are maximum projections of total cellular LTR fluorescence in control cells (KH), cells subjected to 2 h ischemia followed by 1.5 h reperfusion (sI/R), and cells incubated in bafilomycin A1-containing KH solution (KH + Baf A1) to exemplify LTR staining during compromised vacuolar H

+-ATPase activity. (B) Cells were loaded with

MagicRed cathepsin B substrate during the last 30 min of the experiment. Shown are maximum projections of MagicRed stacks in control cells (KH), cells subjected to 2 h ischemia followed by 1.5 h reperfusion (sI/R), and cells incubated in lysosomal inhibitor-containing KH solution (KH + i) to illustrate MagicRed staining under cathepsin B inhibition. Similar results were obtained with LTR and MagicRed after 5 h reperfusion (data not shown).

RESULTS: Autophagy protects against sI/R

V

86

A

B

KH sI/R

KH sI/R

Mag

icR

ed

LT

R

KH + Baf A1

KH + i

V-3 Unraveling the role of autophagy in sI/R injury

The above results demonstrate that formation of AVs is suppressed during ischemia, and

that autophagic flux only partially recovers during reperfusion. As such, to determine

whether autophagy represents a protective response or a component of injury, we altered

the autophagic pathway using pharmacological and molecular perturbations at the levels

of induction and/or formation of AVs.

V-3.1 Pharmacological perturbation of autophagy induction influences sI/R injury

Phosphatidylinositol 3-kinases (PI3-K) exert opposing actions on the autophagic

pathway, with class I PI3-K inhibiting and class III PI3-K stimulating autophagy (Petiot

et al., 2000). The PI3-K inhibitors 3-methyladenine (3-MA) and wortmannin (Arcaro

and Wymann, 1993; Blommaart et al., 1997) are used as inhibitors of autophagy at the

sequestration step due to their inhibition of class III PI3-K (Seglen and Gordon, 1982;

Seglen and Bohley, 1992). Conversely, the inhibition of autophagy by class I PI3-K is

mediated through its downstream action on mammalian target of rapamycin (mTOR)

RESULTS: Autophagy protects against sI/R

V

87

which negatively controls autophagy. Inhibition of mTOR with the immunosuppressant

rapamycin results in the induction of autophagy (Blommaart et al., 1995; Noda and

Ohsumi, 1998; Ravikumar et al., 2006).

Cells were treated with either 10 mM 3-MA or 100 nM wortmannin, to inhibit

autophagy, or with 1 µM rapamycin, to enhance autophagy. To verify the effect on

autophagic flux, GFP-LC3 expressing cells were incubated with the indicated inhibitors

and autophagic flux was evaluated in KH solution. Both 3-MA and wortmannin

completely abolished autophagic flux in KH solution (Fig. 29A). During sI/R this was

reflected in a complete lack of AV accumulation in cells treated with 3-MA and

wortmannin (Fig. 29B). Treatment with rapamycin on the other hand increased autophagy

in KH solution at the level of AV formation (Fig. 29A). It can be concluded that

rapamycin-induced AV formation exceeds the capacity for AV degradation, since

although a maximal percentage of cells showed active autophagy as revealed by

lysosomal inhibition, the percentage of cells with high steady-state AVs increased

significantly. During sI/R, rapamycin-treated cells still displayed numerous AVs (Fig.

29B). Determination of autophagic activity during sI/R revealed that rapamycin did not

rescue autophagy during ischemia, but increased autophagic flux at 1.5 h reperfusion as

fewer cells displayed steady-state accumulation of AVs (Fig. 29C).

The effect of pharmacological interference with the activation of autophagy on

sI/R-induced cellular injury was evaluated based on mitochondrial clustering of GFP-Bax

(Fig. 30A). Under normoxic control conditions, over the duration of the experiment both

3-MA and wortmannin slightly increased basal levels of GFP-Bax clustering. Incubation

with 3-MA and wortmannin prior to and during sI/R resulted in a significant aggravation

of cellular injury.

Similarly, disruption of lysosome function increased sI/R injury. Under normoxic

control conditions lysosomal inhibition did not affect cell viability for up to 7 hours, as

assessed by GFP-Bax clustering (Fig. 30B). However, lysosomal inhibition significantly

increased GFP-Bax clustering following sI/R, indicating that lysosomal proteases do not

exert pro-apoptotic functions during sI/R but rather participate in the maintenance of cell

survival. In contrast, cells treated with rapamycin were significantly protected against

sI/R injury, suggesting that autophagy may serve a pro-survival role during sI/R injury.

RESULTS: Autophagy protects against sI/R

V

88

0

10

20

30

40

50

ISCH ISCH + Rm sI/R sI/R + Rm

% c

ells

with

nu

mero

us G

FP

-LC

3

va

cu

ole

s

Steady-state AVs Cumulative AVs

0.8 -0.7

16.6 21.9

0

20

40

60

80

100

Control Rm 3-MA Wm

% c

ells

with

nu

me

rou

s G

FP

-LC

3

vacu

ole

s

Steady-state AVs Cumulative AVs

78.1 58.7

0.5 -2.2

A

C

B

Control

Rm

3-MA

Wm

sI/R

*

*

FIG. 29. Pharmacologic interference with autophagy induction. Cells were pre-treated with the indicated inhibitors for 1 h in Claycomb medium prior to incubation in experimental conditions. Inhibitors were also present in both ischemic and reperfusion buffers. (A) GFP-LC3 expressing

cells were pre-treated with rapamycin (Rm, 1 µM), 3-MA (10 mM), or wortmannin (Wm, 100 nM) for 1 h in Claycomb medium and then incubated in KH solution with and without lysosomal inhibitors for 2 h. Rm, 3-MA, and Wm were also present during incubation in KH solution. The presence of punctate GFP-LC3-positive AVs was then assessed per incubation condition (*p<0.001). (B) Representative images of cells treated with the indicated inhibitors and subjected to sI/R are shown. (C) GFP-LC3 expressing cells were subjected to 2 h ischemia followed by 1.5 h reperfusion with and without rapamycin. Autophagic flux was then determined as described above (*p<0.05 (sI/R vs. sI/R + Rm flux).

RESULTS: Autophagy protects against sI/R

V

89

0

10

20

30

40

50

60

70

Control Rm 3-MA Wm

% c

ells

with

pun

cta

te G

FP

-Ba

x

KH sI/R

0

10

20

30

40

50

Control Lys. Inh's

% c

ells w

ith

pu

ncta

te G

FP

-Ba

x .

KH sI/R

*

A

B

*

*

**

†

**

FIG. 30. Effect of pharmacological interference upstream of AV formation on sI/R injury. (A) GFP-Bax expressing cells were pre-treated with the indicated inhibitors for 1 h in Claycomb medium prior to incubation in experimental conditions (Wm, wortmannin; Rm, rapamycin). Inhibitors were also present in both ischemic and reperfusion buffers. At 5 h of reperfusion, GFP-Bax expressing cells were classified as displaying diffuse cytosolic or punctate mitochondrial GFP-Bax localization. Represented is the percentage of cells with punctate GFP-Bax distribution per total cells scored (†p<0.05 vs. normoxic control; *p<0.05 and **p<0.001, vs. sI/R control). (B) GFP-Bax expressing cells were subjected to sI/R in the presence of the lysosomal inhibitor cocktail. At 5 h of reperfusion cells were classified as displaying diffuse cytosolic or punctate mitochondrial GFP-Bax localization. Represented is the percentage of cells with punctate GFP-Bax distribution per total cells scored (*p<0.05).

RESULTS: Autophagy protects against sI/R

V

90

V-3.2 Beclin1 protects from sI/R-activated injury and increases autophagic flux

The above results implicate autophagy as a protective response to I/R injury. However,

the pharmacological reagents employed are known to also exert effects unrelated to

autophagy (Caro et al., 1988; Brunn et al., 1996; Xue et al., 1999). We therefore sought

to confirm these findings by targeting specific proteins in the autophagic pathway.

Beclin1, which is endogenously expressed in HL-1 cells (Fig. 31A), is a necessary

participant in AV formation and also believed to take part in the trafficking of lysosomal

proteins (Liang et al., 1999; Kihara et al., 2001). We examined the effect of

overexpression of Beclin1 on sI/R-induced cellular injury. Similar to the protective

effect of rapamycin, cells which had been transiently transfected with Beclin1 were

significantly protected against sI/R-induced GFP-Bax clustering (Fig. 31B).

We subsequently reduced Beclin1 expression using the Block-iT miR RNAi

vector which bicistronically encodes for GFP as an expression marker. We found that 96

hours of expression were necessary in order to achieve a significant knock-down of

Beclin1 (Fig. 31C). Beclin1 silencing aggravated cellular injury after sI/R (Fig. 31D, E),

revealing that autophagic activity following sI/R, although somewhat impaired, is a

crucial component of the cell’s survival response.

FIG. 31. (Next page) Beclin 1 overexpression protects against sI/R injury. (A) Total Beclin1 expression levels were compared between whole cell lysates of control cells and cells transiently

transfected with flag-Beclin1 (61 kDa) or flag-Beclin1∆Bcl2BD (52 kDa) for 48 h. Immunodetection of total Beclin1 demonstrated successful overexpression of constructs. (B)

Cells were co-transfected with GFP-Bax and empty vector, flag-Beclin1, or flag-Beclin1∆Bcl2BD. At 5 h reperfusion, cellular injury was assessed by scoring cells with mitochondrial translocated GFP-Bax. Represented is the percentage of cells with punctate GFP-Bax distribution per total cells scored (*p<0.01). (C) Cells were transfected with a vector encoding RNAi against either Beclin1 or LacZ. Whole cell lysates were prepared after 96 h of expression (at which time transfection efficiency was ~30%) and used for immunoblot detection of protein downregulation. (D) For assessment of cellular injury, cells were co-transfected with mCherry-Bax and the RNAi vectors as indicated. Co-expression of mCherry-Bax and RNAi after 96 h was confirmed with the help of GFP which is bicistronically included in the RNAi vectors. (E) 96 h after transfection, cells were subjected to sI/R and GFP-positive cells with mitochondrial mCherry-Bax were scored and quantified as described above (*p<0.05).

RESULTS: Autophagy protects against sI/R

V

91

0

10

20

30

40

50

60

70

Vector Beclin1 Beclin1

∆Bcl2BD

% c

ells w

ith

pu

ncta

te G

FP

-Ba

x .

KH sI/R

0

10

20

30

40

50

LacZ RNAi Beclin1 RNAi% c

ells w

ith

pu

ncta

te m

Ch

err

y-B

ax . KH sI/R

A B

Beclin1

Beclin1∆Bcl2BD

Actin

Beclin

1∆

Bcl2

BD

Contr

ol

Beclin

1

Contr

ol

Actin

Beclin1

C DGFP-RNAi mCherry-Bax

E

Beclin

1 R

NA

i

LacZ

RN

Ai

Actin

Beclin1

*

*

RESULTS: Autophagy protects against sI/R

V

92

To determine if protection conferred by Beclin1 overexpression correlated with

increased autophagic flux, LC3 processing was quantified in cells expressing Beclin1

following sI/R. Fluorescence analysis of GFP-LC3 co-transfected cells revealed a

significant increase in autophagic flux after sI/R, as the percentage of cells with steady-

state accumulation of AVs was decreased (Fig. 32A).

The interaction between Beclin1 and the class III PI3-K, Vps34, is a prerequisite

for the induction of autophagy (Kihara et al., 2001), through the generation of

phosphatidylinositol 3-phosphate (PI3-P) which functions as a second messenger to

activate autophagy (Petiot et al., 2000). To obtain insight into the effect of Beclin1 on

the initiation of AV formation, we utilized GFP-2xFYVE, a sensor for the intracellular

presence and distribution PI3-P. The binding pocket of FYVE is specific for PI3-P

(Vieira et al., 2001), and upon generation of PI3-P, GFP-2xFYVE concentrates at sites of

production, allowing for a qualitative measure of PI3-P. Under control conditions (KH

solution) and at 1.5 h reperfusion, vesicular accumulation of GFP-2xFYVE was detected.

This labeling was dependent on PI3-K activity, as treatment with wortmannin resulted in

a homogenous distribution of GFP-2xFYVE. In KH solution and during reperfusion,

both control cells and cells overexpressing Beclin1 exhibited large clusters of GFP-

2xFYVE-labeled vesicles, indicating a robust generation of PI3-P (Fig. 32D).

V-3.3 Beclin1 protection against sI/R injury requires a functional Bcl-2 binding domain

Beclin1 contains a Bcl-2 binding domain which has been shown to interact with the anti-

apoptotic Bcl-2 family members Bcl-2 and Bcl-xL (Liang et al., 1998; Pattingre et al.,

2005). In Chapter IV we found that the autophagic response to starvation requires a

functional Beclin1 Bcl2 binding domain (IV-2.4). To determine whether the protection

conferred by Beclin1 following sI/R was regulated by the Bcl-2 family, we made use of a

Beclin1 deletion mutant, Beclin1∆Bcl2BD, which lacks the Bcl-2 binding domain (Liang

et al., 1998) (Fig. 31A), but still can function in autophagy induction (Pattingre et al.,

2005; Shibata et al., 2006). Beclin1∆Bcl2BD reduced autophagic activity during the

reperfusion period as reflected in a decreased percentage of cells with steady-state

accumulation of AVs as well as a complete absence of autophagic flux (Fig. 32A).

RESULTS: Autophagy protects against sI/R

V

93

Unlike overexpression of Beclin1, Beclin1∆Bcl2BD expression did not confer protection

against sI/R injury (Fig. 31B), confirming a cytoprotective role for autophagy.

Beclin1∆Bcl2BD may interfere with endogenous Beclin1 interaction with the PI3-K,

Vps34, as PI3P-induced GFP-2xFYVE clustering was decreased under control

conditions, and at 1.5 h reperfusion (Fig. 32B).

0

10

20

30

40

50

60

sI/R + Vector sI/R + Beclin1 sI/R + Beclin1

∆Bcl2BD

% c

ells

with

nu

me

rou

s G

FP

-LC

3

va

cu

ole

s

Steady-state AVs Cumulative AVs

19.5 31.3

8.1

A

B

*

**

KH

sI/

R

Vector Beclin1 Beclin1∆Bcl2BD

Wm

FIG. 32. Beclin1-mediated protection in sI/R correlates with its effect on autophagy. (A)

Cells were co-transfected with GFP-LC3 and empty vector, Beclin1, or Beclin1∆Bcl2BD. At 1.5 h reperfusion, autophagic flux was determined via fluorescent imaging of GFP-LC3-II without (steady-state AVs) and with (cumulative AVs) lysosomal inhibitors. Represented is the percentage of cells with numerous GFP-LC3 vacuoles per total cells scored (*p<0.01; **p<0.05; flux Vector vs. Beclin1: p<0.05). (B) Cells were co-transfected with GFP-2xFYVE and empty

vector, Beclin1, or Beclin1∆Bcl2BD and incubated in KH or subjected to 2 h ischemia followed by 1.5 h reperfusion. Shown are representative cells of each condition.

RESULTS: Autophagy protects against sI/R

V

94

V-3.4 Inhibition of Atg5 aggravates injury and counteracts protection conferred by Beclin1

We next sought to determine whether the protective effect exerted by Beclin1 was

specific to autophagy, or rather the result of a perturbation in the ratio of pro- and anti-

apoptotic Bcl-2 family members, via binding of Beclin1 to Bcl-2 and/or Bcl-xL. To do so

we targeted Atg5, a necessary component of the autophagic machinery downstream of

Beclin1 activity (Mizushima et al., 2001). We utilized mCherry-Atg5 and the dominant

negative mCherry-Atg5K130R

which were characterized in Chapter IV (IV-2.3).

Autophagic flux at 1.5 h following sI/R was virtually the same for cells

expressing mCherry-Atg5 and mCherry alone, suggesting that Atg5 is not a rate-limiting

factor in the autophagic response to sI/R. Conversely, mCherry-Atg5K130R

significantly

reduced autophagy during sI/R (Fig. 33A). To assess the consequence of reducing

autophagy via expression of mCherry-Atg5K130R

, HL-1 cells were co-transfected with

GFP-Bax and either mCherry-Atg5, mCherry-Atg5K130R

, or mCherry alone, and subjected

to sI/R (Fig. 33B). Consistent with the lack of an effect on autophagic flux, mCherry-

Atg5 expression did not affect sI/R-induced GFP-Bax activation. Similar to the results

obtained through silencing of Beclin1, mCherry-Atg5K130R

expression resulted in

increased GFP-Bax clustering, indicating that residual autophagic activity represents an

underlying protective response to sI/R.

Finally, to determine if Beclin1-mediated protection was due to its effect on

autophagy, we blocked autophagy with mCherry-Atg5K130R

in Beclin1 overexpressing

cells. Strikingly, protection resulting from Beclin1 expression was lost when co-

expressing mCherry-Atg5K130R

, indicating that Beclin1 protection is entirely linked to its

role in increasing autophagy (Fig. 33C).

RESULTS: Autophagy protects against sI/R

V

95

0

10

20

30

40

50

60

Vector Atg5 Atg5(K130R)% c

ells w

ith

pun

cta

te G

FP

-Bax . KH sI/R

0

10

20

30

40

50

60

70

80

Vector Beclin1 Beclin1 +

Atg5(K130R)

% c

ells w

ith

pu

ncta

te G

FP

-Bax .

KH sI/R

Figure 33. Hamacher

C

A

*

*

**

B

0

10

20

30

40

50

sI/R + Vector sI/R + Atg5 sI/R +Atg5(K130R)

% c

ells

with

num

ero

us G

FP

-LC

3

vacuole

s

Steady-state AVs Cumulative AVs

11.1 9.9

3.4

*

FIG. 33. Inhibition of Atg5 increases sI/R injury and abolishes protection through Beclin1. Cells were transfected with either (A) GFP-LC3 or (B) GFP-Bax together with mCherry-Atg5, mCherry-Atg5

K130R, or mCherry alone (Control) and allowed to express for 48 h. Co-expression

of GFP and mCherry was found to be >95%. (A) Autophagic flux at 1.5 h reperfusion was determined via scoring of mCherry-positive cells with numerous GFP-LC3 vacuoles without (steady-state AVs) and with (cumulative AVs) lysosomal inhibitors. Represented is the percentage of cells with numerous GFP-LC3 vacuoles per total cells scored (*p<0.01). (B) Cells were subjected to simulated ischemia followed by 5 h reperfusion, and cellular injury was assessed by scoring mCherry-positive cells with mitochondrial-translocated GFP-Bax. Represented is the percentage of cells with punctate GFP-Bax distribution per total cells scored (*p<0.01). (C) Cells were co-transfected with GFP-Bax and Beclin1 plus mCherry, Beclin1 plus mCherry-Atg5

K130R and subjected to sI/R 48 h after transfection. mCherry-positive cells with

mitochondrial GFP-Bax were scored and quantified as described above (*p<0.001; **p<0.05).

Chapter 6

Mitophagy as Part of the Autophagic Survival Response

during Simulated Ischemia/Reperfusion Injury in HL-1

Cardiac Myocytes

___________________________________________________________________

Adapted from: Hamacher-Brady A., Brady N.R., Logue S.E., Sayen M.R., Jinno M.,

Kirshenbaum L.A., Gottlieb R.A., and A.B. Gustafsson (2006). “Response to myocardial

ischemia/reperfusion injury involves autophagy and Bnip3.” Cell Death Differ., in press.

RESULTS: Mitophagy VI

99

The central importance of mitochondria in determining cell viability following I/R has

been increasingly recognized in recent years. Preservation of mitochondrial integrity is

essential for the survival of the cardiac myocyte as it guarantees the maintenance of the

cell’s energetic homeostasis, while compromised mitochondrial integrity ultimately leads

to the conversion of mitochondria into executers of programmed cell death. In Chapter

III we observed that mitochondrial networks of HL-1 cells fragmented during sI/R.

Reformation of the mitochondrial network correlated with cell viability, whereas

fragmented mitochondria eventually became targets of pro-apoptotic Bax. Autophagy is

a mechanism capable of removing organelles such as mitochondria (mitophagy) and, as

described in Chapter V, autophagy is a powerful protective pathway against I/R injury.

As mitochondrial dysfunction is a key component in I/R injury and ultimately

decides cell fate, we hypothesized that autophagy may help maintaining cell viability via

the selective scavenging of pro-apoptotic mitochondria. As such, autophagy would allow

a cardiac myocyte to remain viable up to a threshold, which would be a balance between

the removal of dysfunctional mitochondria and the ability of the remaining mitochondria

to meet the energetic demands of the cell. We speculated that in sI/R dysfunctional

mitochondria would be removed via autophagy. Using sI/R of the cardiac HL-1 cell line

as an in vitro model of I/R injury to the heart and overexpression of Bnip3 as a surrogate

for I/R-induced mitochondrial damage we investigated the relationship between

mitochondrial dysfunction and autophagy.

RESULTS: Mitophagy VI

100

VI-1 Fragmented mitochondria are targets of autophagy during

reperfusion

sI/R-activated mitochondrial fragmentation (Chapter III) coincides spatially with the

accumulation of AVs occurring at reperfusion (Chapter V), as both fragmented

mitochondria (Fig. 8A) and AVs (Fig. 26A) were predominantly present in perinuclear

regions.

Dysfunctional mitochondria can be removed from the cell via autophagy (Elmore

et al., 2001; Lemasters, 2005; Priault et al., 2005). Studies employing electron

microscopy have previously shown that mitophagy occurs in the heart. In the perfused

rabbit heart model, Decker and Wildenthal demonstrated that autophagic sequestration of

mitochondria was a prominent event during the reperfusion phase following a mild

hypoxic insult (Decker et al., 1980; Decker and Wildenthal, 1980). To investigate if

mitochondria were sequestered by autophagosomes in our model of sI/R, we performed

3D imaging of HL-1 cells co-transfected with mito-DsRed2 and GFP-LC3 in order to

detect mitochondrial autophagy with high spatial resolution.

Merged Z-stacks of mito-DsRed2 and GFP-LC3 fluorescence taken of live cells

after sI/R indicated the colocalization of mitochondria and AVs, as seen in the 3-plane

view of Fig. 34A. Detailed image analysis revealed that small mitochondrial fragments

were in fact present within the GFP-LC3 labeled structures, i.e. undergoing mitophagy

(Fig. 34B). Since autophagy is likely to fulfill functions in addition to the removal of

mitochondria, it is to be expected that not all autophagosomes contain mitochondria.

Furthermore, during the execution of mitophagy, once delivered to the lysosome, mito-

DsRed2 fluorescence is quenched at low pH and degraded by lysosomal proteases.

RESULTS: Mitophagy VI

101

XY

XZ

ZYXY

XZ

ZY

Mito-DsRed2 GFP-LC3 Merge

A

B

FIG. 34. sI/R leads to autophagic sequestration of fragmented mitochondria. HL-1 cells were co-transfected with mito-DsRed2 and GFP-LC3 to simultaneously visualize mitochondria and autophagosomes and subjected to 2 h ischemia in hypoxic pouches followed by reperfusion in normoxic KH solution. Live cells were then analyzed by fluorescence microscopy. (A) Shown

is the 3-plane view of a 3D deconvolved Z-stack acquired at 60x magnification with 0.3 µm increments at 90 min reperfusion. (B) 3D reconstructions of merged GFP-LC3 and mito-DsRed2 fluorescence were produced with ImageJ of a subcellular region with apparent colocalization of

mito-DsRed2 and GFP-LC3 (arrow in (a)). Scale bar, 1 µm.

RESULTS: Mitophagy VI

102

VI-2 Bnip3 overexpression as a surrogate for sI/R-induced mitochondrial

dysfunction

We hypothesize that mitophagy could constitute a cytoprotective mechanism during sI/R

via the selective scavenging of dysfunctional mitochondria. To test this hypothesis, we

employed overexpression of Bnip3 as a model for sI/R-activated mitochondrial

dysfunction.

Bnip3 is a pro-apoptotic member of the Bcl-2 family and is known to exert its

pro-apoptotic function by compromising mitochondrial integrity (Vande Velde et al.,

2000). Overexpression of Bnip3 has been shown to induce cell death related to MPTP

activation, increased ROS production and autophagic activity (Chen et al., 1997; Daido et

al., 2004; Kanzawa et al., 2005). As such, Bnip3 may be an important point of crosstalk

between the apoptotic and autophagic pathways. We speculated that Bnip3-induced

mitochondrial dysfunction was connected to its autophagy-inducing properties, rendering

it a suitable model to mimic and study the relationship between sI/R-induced

mitochondrial dysfunction and autophagy in isolation from other molecular events

occurring during sI/R.

Bnip3 is expressed at high levels in the adult myocardium and contributes to I/R-

induced mitochondrial dysfunction in the ex vivo heart (Hamacher-Brady et al., 2006).

First, we verified that similarly Bnip3 contributes to sI/R injury in HL-1 cells using RNAi

knockdown of Bnip3 (Fig. 35A). Cells transfected with RNAi directed against Bnip3

were significantly protected against sI/R-induced GFP-Bax activation (Fig. 35B),

demonstrating that Bnip3 is a mediator of injury in our in vitro model of sI/R.

RESULTS: Mitophagy VI

103

A

0

10

20

30

40

50

LacZ RNAi Bnip3 RNAi

% c

ells w

ith

pu

ncta

te G

FP

-Ba

x .

KH sI/R

*

B

FIG. 35. Bnip3 mediates sI/R injury in the HL-1 cardiac myocyte. (A) Cells were transfected with RNAi directed against LacZ, as a control, or Bnip3. 48 h after transfection, cell lysates were analyzed for Bnip3 content via Western blotting. (B) Cells were co-transfected with GFP-Bax and RNAi against LacZ or Bnip3. After 48 h of expression, cells were subjected to sI/R and GFP-Bax clustering was analyzed (*p<0.01).

Furthermore, overexpression of Bnip3 resulted in cell death over extended periods

of time, detectable over 24-72 h (Fig. 36), indicating that overexpression of Bnip3 is

sufficient to exert its pro-apoptotic function.

0

10

20

30

40

50

24 h 48 h 72 h

% c

ell d

ea

th

Control Bnip3

FIG. 36. Bnip3 overexpression activates cell death in HL-1 cardiac myocytes. Cells were transfected with either empty vector (Control) or Bnip3 and cell death was monitored using YoPro1 as a vital exclusion dye. Similar results were obtained in three independent experiments.

RESULTS: Mitophagy VI

104

VI-3 Bnip3 induces autophagy in cardiac HL-1 cells

A unique feature of Bnip3 is its C-terminal transmembrane (TM) domain which is

required for its pro-apoptotic function, including its targeting to the mitochondria (Chen

et al., 1997; Yasuda et al., 1998). Bnip3∆TM, which lacks this transmembrane domain,

has been shown to act as a dominant negative, blocking Bnip3-induced cell death

(Kubasiak et al., 2002; Regula et al., 2002; Kothari et al., 2003). Accordingly, we used

Bnip3∆TM expression to investigate the effects of Bnip3 on mitochondria.

To investigate the link between I/R-induced autophagy and Bnip3 activation, HL-

1 cells were transiently transfected with wild type Bnip3 or Bnip3∆TM. The level of

autophagy was assessed under normoxic conditions in full medium. As shown in Fig.

37A and B, overexpression of Bnip3 caused a significant increase in the steady-state

levels of AVs compared to control cells. In contrast, Bnip3∆TM-transfected cells did not

show a significant increase in AV levels. As demonstrated in Chapters IV and V,

increased basal levels of AVs do not sufficiently report autophagic activity. To

investigate if the Bnip3-induced increased number of AVs reflected increased autophagic

flux or an accumulation of AVs due to compromised downstream degradation, we

employed inhibition of lysosomal activity. As introduced in Chapter IV, the difference

between the accumulation of GFP-LC3-labeled AVs under steady-state conditions and

conditions of lysosomal inhibition serves as a quantitative index of autophagic activity.

We found that Bnip3 increased both AV formation and autophagic flux (Fig. 37C).

RESULTS: Mitophagy VI

105

A

B C

Control Bnip3 Bnip3∆TM

0

20

40

60

80

100

pcDNA3.1 Bnip3

% c

ells

with

num

ero

us G

FP

-LC

3

va

cu

ole

s

Steady-state AVs

Cumulative AVs

**

0

20

40

60

80

Control Bnip3

% c

ells

with

nu

me

rou

s G

FP

-LC

3va

cu

ole

s

Bnip3∆TM

*

Control

FIG. 37. Bnip3 overexpression increases autophagic flux in full medium. (A) HL-1 cells

were co-transfected with GFP-LC3 and empty vector (Control), Bnip3, or Bnip3∆TM. After 48 h, the extent of autophagy was assessed by analyzing staining patterns of GFP-LC3. (B) Quantification of autophagy in transfected cells. Overexpression of Bnip3 in cardiac myocytes significantly increased the abundance of AVs (*p<0.05). (C) HL-1 cells were co-transfected with GFP-LC3 and empty vector (Control) or Bnip3. 48 h following transfection, cells were incubated with the lysosomal inhibitor cocktail for 7 h in full medium. Quantification of autophagic flux demonstrates that lysosomal inhibitors dramatically increased the abundance of AVs, and that Bnip3 increased autophagic flux (p<0.01).

In addition, we stained Bnip3-transfected cells with LysoTracker Red (LTR) to

monitor activity of the lysosomal compartment. We found co-localization of GFP-LC3

and LTR, indicating fusion between autophagosomes and lysosomes (Fig. 38). No

differences were observed in total LTR staining between control and Bnip3-

overexpressing cells (data not shown). Notably, LTR staining was dispersed throughout

the cell in control cells, but was more concentrated to regions of high autophagosomal

content in Bnip3 overexpressing cells.

RESULTS: Mitophagy VI

106

GFP-LC3

LTR

FIG. 38. Fusion between AVs and lysosomes seems functional in Bnip3-overexpressing cells. 48 h following co-transfection with GFP-LC3 and Bnip3, HL-1 cells were loaded with 50 nM LTR. Co-localization of LysoTracker Red (LTR) and GFP-LC3 demonstrates formation of autophagolysosomes. LTR staining was prominent in the area containing

autophagosomes. Scale bar, 10 µm.

VI-4 Bnip3 causes autophagy of mitochondrial fragments

Several studies have reported that Bnip3 overexpression causes mitochondrial

dysfunction. Closer examination of mitochondria in Bnip3-transfected cells revealed a

widespread fragmentation of the mitochondrial network, whereas cells transfected with

vector or Bnip3∆TM had typical filamentous mitochondria (Fig. 39).

Control Bnip3 Bnip3∆TM

FIG. 39. Bnip3 overexpression results in fragmentation of the mitochondrial network. Cells

were co-transfected with mito-DsRed2 and vector (Control), Bnip3, or Bnip3∆TM and images were acquired of live cells 48 h after transfection. Shown are maximum projections of representative images.

Above we described that in sI/R fragmented mitochondria were targets of

autophagy (Fig. 34). To investigate if autophagic removal of mitochondria was caused

RESULTS: Mitophagy VI

107

by sI/R-induced mitochondrial damage, we investigated whether Bnip3 overexpression

would likewise lead to mitophagy. To detect mitophagy we employed laser scanning

confocal microscopy of cells expressing mito-DsRed2-labeled mitochondria and GFP-

LC3-labeled autophagosomes. Analysis of generated Z-stacks revealed extensive

mitophagy in Bnip3-cotransfected HL-1 cells, where many GFP-LC3 labeled

autophagosomes co-localized with fragmented mitochondria (Fig. 40A). 3D surface

rendering of confocal Z-stacks revealed different stages of engulfment of individual

mitochondria (Fig. 40B). We did not observe instances of mitophagy in control or

Bnip3∆TM transfected cells (data not shown).

VI-5 Autophagy is a protective response against Bnip3-induced cell death

In Chapter V we showed that enhancing autophagy protects against sI/R injury. We

hypothesized that this protection was partly due to the sequestration of dysfunctional

mitochondria since mitophagy was a prominent feature of the autophagic response to sI/R

(Fig. 34). Bnip3 is involved in I/R-induced mitochondrial dysfunction (Hamacher-Brady

et al., 2006) and we found that overexpression of Bnip3 leads to mitophagy (Fig. 40).

Thus, we investigated whether autophagy protects against Bnip3-induced cell injury.

We found that overexpression of autophagy protein Beclin1 protected against

Bnip3-mediated cell death in HL-1 cells (Fig. 41A). Conversely, co-expression of

Beclin1∆Bcl2BD aggravated Bnip3-induced cell death, further indicating the importance

of physiologically regulated Beclin1. Similarly, overexpression of Atg5 significantly

reduced Bnip3-mediated cell death (Fig. 41B). In contrast, the dominant negative

Atg5K130R

increased Bnip3-mediated cell death.

Together, these results indicate that autophagy protects against Bnip3-mediated

mitochondrial dysfunction in sI/R via the selective scavenging of malfunctioning

mitochondria.

RESULTS: Mitophagy VI

108

Mito-DsRed2LC3-GFP

BNIP3

Mito-DsRed2LC3-GFP

BNIP3

(i)

(ii)

Mitochondrial sequestration

Sequesteredmitochondrion

A

B

FIG. 40. Bnip3 overexpression activates mitophagy. HL-1 cells were co-transfected with mito-DsRed2, GFP-LC3and Bnip3. 48h following transfection GFP-LC3 distribution and mito-DsRed2-labeled mitochondria were detected by 3D confocal imaging. (A) Mitochondria appeared

fragmented and were observed within autophagosomes. Scale bar, 3 µm. (B) Surface volume rendering reveals the mitophagic process in 3D showing different stages of mitochondrial engulfment in Bnip3 overexpressing cells: (i) mitochondrion undergoing sequestration (A, open arrow), and (ii) engulfed mitochondrion (A, closed arrow).

RESULTS: Mitophagy VI

109

0

10

20

30

40

50

60

Vector Beclin1 Beclin1∆Bcl2BD

Bnip

3-ind

uce

d c

ell

de

ath

(% Y

oP

ro1

-po

sitiv

e c

ells

)

*

**A

B

0

10

20

30

40

50

60

Bn

ip3

- ind

uce

d c

ell

death

(% Y

oP

ro1

- po

sitiv

e c

ells

)

Vector Atg5 Atg5K130R

70*

*

FIG. 41. Modulation of autophagy affects Bnip3-mediated cell death. (A) Cells were co-transfected with DsRed2 as a transfection marker and Bnip3 together with pcDNA3.1, Beclin1, or

Beclin1∆Bcl2BD. At 48 h after transfection, cell death of DsRed2-positive cells was assessed using YoPro1 as a vital exclusion dye (*p<0.01; **p<0.05). (B) Cells were transfected with Bnip3 and mCherry, mCherry-Atg5 or mCherry-Atg5

K130R and cell death was assessed 48 h after

transfection using YoPro1 (*p<0.05).

Chapter 7

Discussion

________________________________________________________________________

DISCUSSION

VII

113

I/R injury results in cell death of cardiac myocytes, a terminally differentiated cell type of

finite number, and consequently reduced myocardial function. Although the relative

contributions of necrosis and apoptosis (PCD type I) are still subject to much debate, both

are established as modes of cell death contributing to I/R injury (Kajstura et al., 1996).

Apoptosis is a highly-regulated genetic program that allows for intervention and thus,

rescue of cells. As such, there is much interest and need in elucidating the participants

and mechanisms involved in the regulation of cardiac myocyte apoptosis in order to

develop pharmaceutical compounds to treat heart disease.

In recent years, autophagy has come to the forefront of scientific attention, due to

the characterization of its molecular mechanism in yeast and the identification of

mammalian homologues of autophagic proteins (Klionsky and Emr, 2000). It has

emerged that autophagy is a crucial process for maintaining cell homeostasis and

disruption to the pathway can be a contributing factor to many diseases. Decreased

autophagy may be causative in the development of cancer (Yue et al., 2003) and

neurodegenerative conditions including Alzheimer’s (Nixon et al., 2005) and Parkinson’s

diseases (Webb et al., 2003; Ravikumar et al., 2004; Shibata et al., 2006). Furthermore,

excessive autophagy is recognized as a form of PCD linked to, but distinct from

apoptosis (Codogno and Meijer, 2005).

A growing number of studies report the prevalence of autophagosomes

(autophagic vesicles, AVs) in cardiac disease. However, the literature to date consists

mainly of correlative studies which infer the role of autophagy as either detrimental or

beneficial: autophagic cell death (PCD type II) has been implicated in myocardial

dysfunction (Hein et al., 2003; Akazawa et al., 2004; Saijo et al., 2004) , however, during

ischemic injury autophagy may be a protective response (Decker and Wildenthal, 1980;

Yan et al., 2005).

Thus, the main objective of this thesis was to investigate the role of autophagy in

I/R-induced activation of cell death pathways. This was accomplished by (1) the

establishment of a cardiac myocyte cell culture model allowing for the quantification of

apoptotic signaling during I/R injury, and (2) developing a sensitive method for detecting

and quantifying changes in autophagic activity. Subsequently, (3) the cause-and-effect

relationship between I/R-activated mitochondrial death signaling (apoptosis) and

DISCUSSION

VII

114

autophagy was examined. Finally, (4) based on the obtained results we investigated the

autophagic removal of mitochondria (mitophagy) as a potential mechanism of protection.

VII-1 Chapter I: HL-1 cell culture model of myocardial I/R injury allowing for

the spatio-temporal investigation of apoptosis-related signaling

pathways

Prerequisite for the investigation of apoptotic signaling in myocardial I/R was the

development and characterization of a cell culture-based model thereof. Prior to this

body of work no such model existed that closely reflected the in vivo situation:

commonly used myocyte cell lines (H9c2, C2C12) and cultured neonatal cardiac

myocytes require prolonged (from 8 to 24 h) hypoxia or simulated ischemia to activate

death signaling pathways (Dougherty et al., 2002; Hollander et al., 2003; Hou and Hsu,

2005). Alternatively, oxidizing agents (e.g. hydrogen peroxide) or initiators of apoptosis

(e.g. staurosporine) are employed as surrogates to explore I/R injury (Capano and

Crompton, 2002; Akao et al., 2003), which do not necessarily recapitulate the events of

I/R injury. We sought to establish an acute model which closely resembles the in vivo

signaling pathways during I/R injury to the heart, using the recently established cardiac

HL-1 cell line which has been described as a successful model for studying many aspects

of cardiac cell physiology (White et al., 2004). As HL-1 cells are readily transfectable,

as opposed to the adult cardiac cell which cannot be transfected using conventional

means, we consider the HL-1 cell a unique system for investigating in a single cell

resolution the pro-death and pro-survival pathways during I/R injury.

We found that HL-1 cells reproducibly underwent PCD in response to an acute (2

h) ischemic insult via pathways resembling in vivo myocardial I/R injury: we

demonstrate that in HL-1 cells sI/R leads to mitochondrial dysfunction, reflected by a

collapse of ∆Ψm and increased mitochondrial ROS production, hallmarks of the I/R

response by adult cardiac myocytes (Honda et al., 2005). In addition, sI/R injury

culminates in a redistribution of pro-apoptotic Bax and Bid, and finally cell death,

revealing a carefully orchestrated cell death program (Fig. 42).

DISCUSSION

VII

115

Of note is that our model of sI/R conferred a rather mild insult, as the cell death

program was executed over a time-course of several hours and therefore allowed us to

study a heterogeneous cell population that, like the injured myocardium in vivo,

comprised (i) cells which had suffered irreversible damage and underwent cell death and

(ii) cells which had undergone sub-lethal stress and were able to recover eventually.

VII-1.1 Mitochondrial dysfunction is an early event in sI/R injury to HL-1 cardiac myocytes

A high ∆Ψm is an excellent indicator for functional mitochondria, which are considered a

crucial parameter of cardiac cell viability (Di Lisa and Bernardi, 1998). Mitochondria

account for 30% of cardiac myocyte volume (Page et al., 1971) and supply the majority

of ATP needed for contraction and maintenance of ionic homeostasis. Apart from

disrupting cellular ATP supply, uncoupling of oxidative phosphorylation, reflected in the

loss ∆Ψm, can lead to increased leak of ROS from the electron transport chain (Vanden

Hoek et al., 1997). ROS production is a causative factor in I/R injury (Vanden Hoek et

al., 1998; Levraut et al., 2003). We found that in the first 90 min of reperfusion, sI/R-

induced mitochondrial dysfunction was apparent, reflected by loss of ∆Ψm and increased

ROS generation.

VII-1.2 Pro-apoptotic Bax activity

By combining 4D imaging of GFP-biosensors and Western blotting, we were able to

characterize the dynamics of pro-apoptotic Bcl-2 family members Bax and Bid, which

are necessary components of the machinery mediating I/R-activated PCD in the heart

(Peng et al., 2001; Hochhauser et al., 2003). GFP-based Bax fusion proteins were used

to quantify sI/R-induced Bax translocation and clustering on mitochondria in relation to

mitochondrial remodeling and depolarization at the level of the single cell.

In response to sI/R, Bax translocation occurred in two phases, a priming phase in

which Bax coated the mitochondria homogeneously, and an activation phase in which

Bax formed discrete clusters on the mitochondria. The coating phase occurred during

ischemia and early reperfusion, whereas clustering occurred hours later. Both phases

were sensitive to the p38 inhibitor SB203580, and thus are likely to be mediated by p38

activity. This is consistent with the recent report by Capano and Crompton (Capano and

DISCUSSION

VII

116

Crompton, 2002), who showed that Bax translocation and coating of mitochondria during

ischemia was dependent on p38.

Bypassing the translocation phase via expression of mCherry-BaxT182A

, which

results in spontaneous Bax translocation to mitochondria, resulted in accelerated

clustering during reperfusion. However, forced Bax translocation alone was not

sufficient to induce mitochondrial dysfunction, indicating that downstream events are

critical in the activation of PCD. Although previous studies have suggested that the loss

of ∆Ψm occurs following Bax and Bid translocation (Scorrano et al., 2002), our data

indicate that in this model, MPTP activation is upstream of Bax clustering. The loss of

∆Ψm is not necessarily indicative of MPTP activity. However, as CsA inhibited Bax

clustering, our results support the notion that sI/R-induced MPTP activation was an

upstream event for the death signal cascades (De Giorgi et al., 2002; Precht et al., 2005).

Importantly, hypoxia/reoxygenation was found to be a necessary component of sI/R, as

incubation of HL-1 cells in normoxic ischemia-mimetic solution (metabolic inhibition

without hypoxia) did not result in Bax activation.

VII-1.3 Bid activation and translocation

CFP-Bid-YFP was employed to track both the N- and C-terminal fragments of Bid. A

surprising finding was that Bid activation, via caspase 8, occurred downstream of Bax

clustering. This appears to contradict previous studies which have shown that Bax and

Bid act in concert to release pro-apoptotic proteins from the mitochondria (Eskes et al.,

2000). However, Bid may function to stimulate or amplify the cell death program by

sequestering Bcl-2/-xL, thereby facilitating the pro-apoptotic actions of Bax (Yi et al.,

2003). Another possibility for the relationship between Bid and Bax is that at sub-

detection levels tBid potentiates Bax clustering, and the second (obvious) phase of Bid

activity involves massive destruction to the mitochondria, ensuring the point of no return.

It is also possible that in this model, Bid is simply a bystander that undergoes processing

at the time of general caspase activation. Further work will be needed to establish the

role of Bid in this system.

Our findings that Bid cleavage is caspase 8-dependent in HL-1 cells is at variance

with previous studies of our lab in isolated perfused hearts which showed that Bid

cleavage was mediated by calpain (Chen et al., 2001), but is consistent with another study

DISCUSSION

VII

117

(Scarabelli et al., 2002). Calpain activation after global ischemia in the ex vivo heart has

been attributed to excessive preload (input pressure at the left atrium) (Feng et al., 2001),

which would be absent from this cell-based model.

VII-1.4 Bcl-2 and Bax activation: role of subcellular localization

Having used the GFP-based Bid and Bax biosensors to characterize the spatial and

temporal dynamics of pro-apoptotic Bcl-2 family member signaling, we subsequently

investigated the role of anti-apoptotic Bcl-2 and Bcl-xL. Both Bcl-2 and Bcl-xL, which

are potent protective proteins in myocardial I/R injury in vivo (Brocheriou et al., 2000;

Huang et al., 2005 Schneider 2004), significantly reduced mitochondrial clustering of

GFP-Bax. Bcl-2 and Bcl-xL oppose apoptotic signals from the mitochondria, through

stabilizing the mitochondrial outer membrane (Susin et al., 1996), and at the S/ER, by

decreasing pro-apoptotic Ca2+

levels (Chami et al., 2004). We found that Bcl-2 targeted

to the mitochondria strongly reduced Bax activation, whereas Bcl-2 targeted to the S/ER

did not afford protection. Thus, in sI/R injury to the HL-1 cardiac myocyte,

mitochondrial dysfunction is the major factor activating pro-death signaling.

Furthermore, these results indicate that apoptotic Ca2+

signaling may not play a dominant

role in I/R injury. In agreement with out findings, mitochondrial Ca2+

-overload was

recently shown to be a secondary event following ROS-induced MPTP opening (Kim et

al., 2006).

It is interesting to note that the physiological implications of S/ER-targeted Bcl-2

in the cardiac myocyte are unclear. Conditions which trigger S/ER-Bcl-2 translocation

have not been shown and it is not known if this is a normally occurring physiological

response. Although enforced Ca2+

release from S/ER stores, by either Bcl-2 or Bcl-xL,

minimizes the Ca2+

signaling component of apoptosis (Chami et al., 2004), it is not

known if S/ER targeted-Bcl-2 affects the ability of the cardiac myocyte to contract. It is

likely that the decrease of S/ER Ca2+

stores would be harmful to the heart by reducing its

capacity to do work.

VII-1.5 sI/R-induced mitochondrial fragmentation

Mitochondria vary in regards to their morphology. They can exist as largely

interconnected networks or as independent units (Collins et al., 2002). Interestingly, we

DISCUSSION

VII

118

found that sI/R led to the fragmentation of the previously branched and elongated HL-1

mitochondria into spherical shaped organelles. Fragmentation of mitochondrial networks

occurs in many instances of PCD (Karbowski et al., 2002; Lyamzaev et al., 2004;

Skulachev et al., 2004), and protein mediators of mitochondrial morphology have been

linked to PCD (Karbowski et al., 2002; Lee et al., 2004). For instance mitofusin2

(Mfn2), which participates in mitochondrial fusion (Santel and Fuller, 2001), has been

shown to stabilize the MPTP and block Bax translocation (Neuspiel et al., 2005), whereas

dynamin-related protein 1 (Drp1), which promotes mitochondrial fission (Smirnova et al.,

2001), has been shown to participate in Bax-mediated cytochrome c release (Frank et al.,

2001; Lee et al., 2004; Jagasia et al., 2005). Conversely, Drp1 mediated fragmentation of

mitochondrial networks has also been shown to be protective by limiting

intramitochondrial propagation of pro-apoptotic calcium signaling (Szabadkai et al.,

2004).

We found that ischemia resulted in fragmentation of the usually elongated and

branched HL-1 mitochondrial population. Unexpectedly, mitochondrial fragmentation

occurred during ischemia, before loss of ∆Ψm and Bax translocation (Fig. 42), indicating

that endogenous Drp1 activation occurs well before becoming engaged with the PCD

pathway. This differs from a report (Karbowski et al., 2002), by Youle’s group which

described Bax translocation before fragmentation in Hela and Cos-7 cells. Interestingly,

at 5 h of reperfusion, SB203580-treated cells displayed elongated mitochondria,

demonstrating that in the absence of Bax and p38 signaling, recovery of mitochondrial

filamentous morphology was possible, supporting the notion of a relationship between

Bax and the morphology machinery (Karbowski et al., 2002; Neuspiel et al., 2005)

We found that by enforcing the fragmented morphology via overexpression of

Drp1, HL-1 cells were protected from sI/R injury, as monitored by GFP-Bax clustering at

the mitochondria. Likewise, overexpression of Bcl-xL protected against sI/R injury

without preventing sI/R-induced mitochondrial fragmentation. Together, these results

indicate that in HL-1 cells mitochondrial fragmentation is a reflection of the sI/R insult

which counteracts the initiation of the apoptotic signaling cascade. We hypothesize that

the protection conferred by Drp1 is in part due to increased spacing between neighboring

mitochondria, thereby maintaining localized ATP delivery needed for contraction as well

DISCUSSION

VII

119

as ionic homeostasis, whilst limiting mitochondrion-to-mitochondrion transmission of

ROS production through ROS-induced ROS release which mediates sI/R injury (Brady et

al., 2004).

VII-1.6 Conclusions

The use of multicolor live-cell imaging enabled us to investigate the spatio-temporal

behavior of Bax and Bid during sI/R, allowing unprecedented inquiry into the

relationship between sI/R-induced pro-apoptotic signaling and mitochondrial dysfunction

pathways.

Furthermore, we conclude that the dynamics of GFP-Bax clustering at the

mitochondria are an informative parameter of irreversible apoptotic injury to the HL-1

cardiac myocyte, enabling us to investigate processes which enhance or inhibit the

tendency of a cell to undergo apoptosis.

Mito

ch

on

dria

l fr

ag

me

nta

tion

Lo

ss

of ∆Ψ

m

Ba

x tr

an

slo

ca

tio

n

Ba

x clu

ste

rin

g

Bid

activa

tio

n

Pla

sm

a m

em

bra

ne

p

erm

ea

bili

za

tio

n

Ischemia Reperfusion

CsA

SB203580

p38

TIME

Ca

sp

ase

8

FIG. 42. Time-line of events during sI/R in HL-1 cells. The scheme is an approximate representation reflecting the observed sequence of events during sI/R. Importantly, no causative relations are depicted. Bax translocation can start during ischemia, however is mostly detectable during reperfusion. Mitochondrial networks can be re-built during reperfusion in the presence of SB203580.

DISCUSSION

VII

120

VII-2 Chapter IV: Investigating autophagy in HL-1 cardiac myocytes

Autophagy is emerging as both an important process for cell physiology, as well as a

putative cytoprotective mechanism in the heart (Kuma et al., 2004; Yan et al., 2005)

(Depre et al., 2004). The characterization of a GFP-LC3 fusion protein is a driving force

in the autophagy field as it functions as a unique and specific indicator for AVs in live

cells (Kabeya et al., 2000). Currently, a demonstration of either punctate GFP-LC3-II

labeled AVs by fluorescence imaging, or LC3-II detection by Western blotting, are the

standard means for detecting changes in autophagic activity. However, it is important to

note that lysosomal degradation of LC3-II varies according to cell type (Mizushima et al.,

2004), and LC3 forms I and II are differentially recognized by the LC3 antibodies

(Kabeya et al., 2004), rendering it difficult to quantify LC3 processing via

immunodetection. Moreover, increased levels of AVs can represent impairment in the

fusion with lysosomes rather than an upregulation in autophagic activity (Trost et al.,

1998). Thus, one crucial objective of Chapter IV was to establish a technique for the

quantitative assessment of autophagy.

VII-2.1 Determination of autophagic flux

It is well known that autophagic activity is upregulated in low nutrient conditions (e.g.

amino acid and/or serum deprivation) when compared to high nutrient conditions (e.g.

fully supplemented culture medium) (Kim and Klionsky, 2000). Furthermore, the

immunosuppressant rapamycin induces autophagy even under high nutrient conditions

(Noda and Ohsumi, 1998), and the dominant negative Atg5K130R

can be used to impair

autophagy at the level of AV formation (Mizushima et al., 2001). Hence, we chose those

settings to develop and gauge a technique for the quantitative assessment of autophagy.

To quantify autophagy in our experimental system, we inhibited lysosomal degradation

and analyzed the accumulation of GFP-LC3-positive AVs during a given amount of time

by fluorescence microscopy. Our results dispute the widely held assumption that cellular

AV (LC3-II) levels correlate with autophagic activity: we show that low AV levels can

reflect either high lysosomal turnover of AVs or low autophagic activity. Cells with low

autophagic activity (full medium), high autophagic activity (nutrient deprivation), and

impaired autophagy (expressing mCherry-Atg5K130R

) all exhibit virtually identical low

steady-state levels of GFP-LC3-labeled AVs. Moreover, high AV levels can reflect either

DISCUSSION

VII

121

enhanced AV formation (rapamycin) or blocked downstream degradation of AVs

(lysosomal inhibition). Thus, the determination of steady-state AV content is not an

adequate qualitative or quantitative index of autophagy. The differences in autophagic

flux are only revealed when lysosomal trafficking is blocked. Consequently, the

difference in GFP-LC3 labeled AV content in the presence and absence of lysosomal

inhibitors is the most informative gauge of the autophagic pathway. Moreover, unlike

commonly used assays measuring degradation of long-lived proteins, the technique we

employed is specific to quantify macroautophagy. Such a distinction is relevant, as

chaperone-mediated autophagy (Paglin et al., 2005), which targets cytosolic proteins, is

strongly stimulated by ketone bodies which form during starvation (Finn and Dice, 2005)

and oxidative stress (Kiffin et al., 2004). In fact, recent findings indicate that CMA and

macroautophagy may have compensating functions (Massey et al., 2006).

VII-2.2 Regulation of Beclin1-mediated autophagy

We then sought to apply our technique for the quantification of autophagic flux to

elucidate the control over the Beclin1-mediated autophagic response exerted by its

putative interacting partner Bcl-2.

VII-2.2.1 Endogenous Bcl-2 promotes Beclin1-mediated autophagy during nutrient deprivation

The nature of the interaction between Beclin1 and Bcl-2/-xL on autophagic activity is

unclear. We found that Beclin1∆Bcl2BD reduced autophagy, indicating that Bcl-2 is a

necessary participant for maximal Beclin1-mediated autophagic activity in the HL-1

cardiac myocyte. In line with this finding, it was shown in MEFs that Bcl-2 and Bcl-xL

promote Atg5-Atg12 conjugation in response to etoposide (Shimizu et al., 2004). On the

other hand, Bcl-2 has been shown to suppress autophagy under certain conditions:

Beclin1∆Bcl2BD functioned similar to wild-type Beclin1 to promote clearance of toxic

huntingtin aggregates in neurons (Shibata et al., 2006) and Beclin1 lacking, or mutated

in, the Bcl-2 binding domain caused a massive accumulation of AVs and induced cell

death in both full medium and under starvation conditions (Pattingre et al., 2005).

Pattingre et al. further demonstrated that AV content was negatively correlated with the

amount of Bcl-2 that interacted with Beclin1, and that Bcl-2 binding of Beclin1 interferes

with the Beclin1-Vps34 interaction which signals autophagy. In support of this model

DISCUSSION

VII

122

the authors showed that high levels of Bcl-2 and Beclin1 co-immunoprecipitated under

high nutrient conditions, and, conversely Bcl-2 did not co-immunoprecipitate with

Beclin1 under low nutrient conditions (Pattingre et al., 2005). However, Zeng et al.

showed that endogenous Bcl-2 did not interact with Beclin1 in U-251 cells under full

medium conditions; only through overexpression of Bcl-2 was this interaction detected

(Zeng et al., 2006). Moreover, Kihara et al. found that under full medium conditions in

HeLa cells all of Beclin1 is bound to the class III PI 3-kinase Vps34 (Kihara et al., 2001).

These diverging reports strongly suggest that rheostatic control of autophagy by Beclin1-

Bcl-2 interaction is not a universal mechanism.

VII-2.2.2 S/ER-localized Bcl-2 depletes S/ER Ca2+-content, thereby inhibiting autophagy

High S/ER Ca2+

stores are required for autophagy (Gordon et al.). We found that S/ER-

Bcl-2 both suppressed autophagic activity similar to the previous report (Pattingre et al.,

2005) and reduced S/ER Ca2+

content, as previously shown (Dremina et al., 2004; Palmer

et al., 2004). Moreover, we directly demonstrated the Ca2+

requirement for autophagic

activity: intracellular chelation of Ca2+

by BAPTA and depletion of S/ER Ca2+

stores by

SERCA inhibitor thapsigargin both significantly suppressed autophagy. Although

overexpression of wild-type Bcl-2 slightly suppressed autophagy, this may reflect the

amount of Bcl-2 protein localized to the S/ER, which was considerably less than when

expressing S/ER-targeted Bcl-2 (results not shown). We speculate that the specialized

S/ER of the HL-1 cardiomyocyte, which contains high SERCA levels, is able to

overcome some degree of Bcl-2 leak and maintain S/ER Ca2+

-content in response to low

levels of Bcl-2 (Palmer et al., 2004), yet would be impaired by supra-physiologic levels

of Bcl-2 at the S/ER (Dremina et al., 2004). It remains unknown if S/ER Ca2+

positively

regulates autophagy, or if high cytosolic Ca2+

suppresses autophagy. One possibility is

that the C2 domain of Vps34 may respond to Ca2+

fluxes to signal the recruitment of the

autophagic machinery to the Golgi membrane (Rizo and Sudhof, 1998).

The findings that overexpression of Bcl-2 leads to S/ER Ca2+

depletion and

suppression of autophagy may be significant in our understanding of the autophagic

processes in the heart. The cardiomyocyte requires an efficient supply and delivery of

ATP from the mitochondria to perform work and maintain ionic homeostasis. Ca2+

couples mitochondrial ATP production to demand (I-3.2.3). We provided evidence that

DISCUSSION

VII

123

Ca2+

homeostasis further is coupled to the vital process of autophagy. Autophagy is

emerging as an important process involved in programmed cell death as well as

cytoprotection. We propose that the inability to mount an autophagic response due to

depleted S/ER Ca2+

is relevant for paradigms of both cellular protection and cell death.

VII-2.3 Conclusions: Chapter IV

We established a technique for the quantitative assessment of macroautophagy based on

the inhibition of lysosomal degradation of AVs. By analyzing the percentage of cells

with numerous AVs without (steady-state AVs) and with (cumulative AVs) lysosomal

inhibition, we can discriminate between (a) the percentage of cells with disrupted

autophagic flux (steady-state AVs), and (b) the percentage of cells with active autophagic

flux (cumulative AVs minus steady-state AVs). Using our novel technique to

systematically determine autophagic flux, we were able to reveal a two-tiered relationship

between autophagic activity and Bcl-2: under normal conditions Bcl-2 is a necessary

participant in autophagy via its interaction with Beclin1, yet under conditions in which

Bcl-2 is artificially concentrated at the S/ER, the consequent depletion of lumenal Ca2+

results in an overriding inhibition of autophagy.

VII-3 Chapter V: Autophagy in sI/R

In Chapter III we established a reproducible model for quantifying sI/R-activated

apoptosis. In Chapter IV we developed tools for perturbing and quantifying the

autophagic pathway with unprecedented precision. We subsequently sought to

investigate the role of autophagy during sI/R injury.

VII-3.1 Autophagic flux during sI/R

Similarly to ex vivo reports of increased AV content during myocardial I/R injury

(Decker et al., 1980; Decker and Wildenthal, 1980), we found that sI/R led to the steady-

state accumulation of AVs in HL-1 cardiac myocytes. However, as described in Chapter

IV, AV content does not correlate with autophagic activity: high steady-state AV content

can be indicative of the cell’s inability to degrade formed AVs, due to either excessive

AV formation, or a disruption of downstream degradation. Utilizing the technique we

developed for determining autophagic flux (Chapter IV), we found that the accumulation

DISCUSSION

VII

124

of GFP-LC3-labeled AVs during sI/R is complex, resulting from simultaneous alterations

in the induction and formation of AVs, their transit to and fusion with lysosomes, and

their ultimate degradation within the autophagolysosomes (Fig. 43). During ischemia,

the formation of AVs was blocked. Rapamycin treatment was unable to increase

autophagy during the ischemic period, whereas autophagic flux was robust in cells

incubated with the ischemic solution under normoxic conditions. As the conjugation

steps performed by E1-like Atg7 during the formation of the AV require ATP (Ichimura

et al., 2000), it is likely that energetic constraints of hypoxia preclude autophagy during

the ischemic period.

Reperfusion led to an increase in the formation, and, to a lesser extent,

degradation, of AVs. However, the autophagic response, i.e. the percentage of cells with

high cumulative AVs, was smaller than that seen in KH solution. Thus, it is likely that

autophagy is impaired at the level of induction. This interpretation is supported by our

finding that Atg5 overexpression did not increase autophagic activity, indicating that the

autophagic machinery downstream of Beclin1-dependent induction was functional and

not a rate-limiting factor.

The steady-state accumulation of AVs in a significant percentage of sI/R-treated

cells indicates a second disruption to the autophagic pathway downstream of AV

formation. One potential mechanism would be lysosomal dysfunction. During the onset

of some forms of PCD lysosomal proteases can be released into the cytosol where they

trigger apoptosis via cleavage of Bid and perhaps other targets (Stoka et al., 2001;

Cirman et al., 2004). Furthermore, decreased activity of the predominant lysosomal

protease cathepsin B has been reported in neuronal apoptosis (Uchiyama, 2001).

However, our experiments did not reveal a disruption of lysosomal function at the level

of the v-ATPase or cathepsin B activity indicating that autophagic flux was impaired

upstream of lysosomes. Consistent with this result, cathepsin inhibition had no effect on

sI/R-activated Bid cleavage (III-6.1). Thus, the observed accumulation of AVs during

sI/R likely reflects impaired delivery to (Webb et al., 2004), or fusion with (Gutierrez et

al., 2004) the lysosomes. Additional support for this explanation is derived from the fact

that we found little colocalization of GFP-LC3-labeled AVs and LTR-stained lysosomes

DISCUSSION

VII

125

after sI/R (data not shown). However, this technique did not allow for quantitative

analysis.

VII-3.2 Enhancing autophagic flux protects against sI/R injury

Enhanced autophagic flux (through rapamycin treatment or Beclin1 overexpression)

reduced sI/R-induced apoptosis. Conversely, pharmacologic inhibition of autophagy

with wortmannin or 3-MA, RNAi knockdown of Beclin1 and overexpression of the

dominant negative Atg5K130R

all sensitized cardiac cells to apoptosis. To the best of our

knowledge, the work presented here demonstrates for the first time that autophagy

constitutes an underlying protective response against I/R injury in heart cells.

Interestingly, protection correlated with enhanced autophagic flux. Both

rapamycin and Beclin1-overexpression increased autophagic flux by decreasing the

percentage of cells with steady-state accumulation of AVs, yet without changing the total

percentage of cells demonstrating active autophagy. In addition to their role in the

initiation of AV formation, Beclin1 and/or Vps34 have been shown to play a role in

sorting of lysosomal proteins (Kihara et al., 2001; Row et al., 2001; Obara et al., 2006).

Rab7, a member of the family of Rab GTPases which regulate transport and

tethering/docking of vesicles (Waters and Pfeffer, 1999), mediates the fusion of AVs with

lysosomes (Gutierrez et al., 2004; Jager et al., 2004). Rab7 also interacts with Beclin1

interacting partner Vps34, (Stein et al., 2003), and it has been suggested that the

localization of Rab7 to AVs is negatively regulated by mTOR (Gutierrez et al., 2004).

We propose that the protection conferred by rapamycin and Beclin1-overexpression is

linked to rescued autophagolysosome formation. Further studies will be needed to

support this hypothesis.

VII-3.3 Protection, Bcl-2, and autophagy

Cellular survival following I/R depends in large part on the interactions between anti-

apoptotic (e.g. Bcl-2, Bcl-xL) and pro-apoptotic (e.g. Bid, Bax) Bcl-2 family members.

Bcl-2 and Bcl-xL are known to protect against I/R injury (Brocheriou et al., 2000; Huang

et al., 2005), and were likewise protective in our model (III-4). We attributed the

protective effect of Bcl-2 to its action at the mitochondria. Moreover, Bcl-2 localized to

the S/ER was found to reduce autophagy due to reduced S/ER Ca2+

-content (IV-4).

DISCUSSION

VII

126

Interestingly, S/ER Bcl-2 did not reduce nor sensitize to sI/R activation of Bax, even

though S/ER Bcl-2 dramatically inhibited the autophagic response to nutrient deprivation.

It is possible that the lower levels of autophagy present during sI/R are less susceptible to

reduced S/ER Ca2+

-content. Alternatively, S/ER Bcl-2 might not further reduce S/ER

Ca2+

-content during sI/R, which is already low due to decreased decreased availability of

ATP during I/R.

Both Bcl-2 and Bcl-xL interact with Beclin1 (Liang et al., 1998). Importantly, the

ability of Atg5K130R

to block the Beclin1-mediated cytoprotection demonstrated that the

protective effect of Beclin1 is due to its enhancement of autophagy rather than a

perturbation of Bcl-2/-xL homeostasis.

Expression of Beclin1 Bcl-2 binding domain mutants has been reported to

increase AV formation and autophagic cell death (Pattingre et al., 2005). However, our

results using lysosomal inhibitors to quantify autophagic flux clearly indicate that

expression of Beclin1∆Bcl2BD decreased autophagy during both nutrient deprivation

(IV-2.4) and sI/R, and furthermore, unlike wild-type Beclin1, did not confer protection

against sI/R. Moreover, expression of either wild-type Bcl-2 or Bcl-xL had no detectable

effect on the autophagic response (data not shown), yet significantly protected against

sI/R injury. The suppressive effect of Beclin1∆Bcl2BD on autophagy indicates that an

interaction between Beclin1 and Bcl-2/-xL is required for full autophagic activity, arguing

for the possibility of coinciding pro-survival activities of both Bcl-2/-xL and autophagy.

In fact, increased expression of both Bcl-2 and Beclin1 have been correlated with

protection during myocardial stunning (Depre et al., 2004; Yan et al., 2005).

VII-3.4 Conclusions: Chapter V

We found that the accumulation of AVs in sI/R injury is indicative of impaired

autophagic flux rather than excessive autophagy. Residual levels of autophagy, although

not maximal, are part of a cellular pro-survival program as inhibition of autophagy via 3-

MA, wortmannin, and Atg5K130R

aggravated sI/R-induced apoptosis. Moreover,

enhancing autophagic flux via rapamycin or overexpression of Beclin1 protected against

sI/R-induced apoptosis. Bcl-2 supports Beclin1-mediated autophagy as a deletion of the

Beclin1 Bcl-2 binding domain decreased autophagic flux in sI/R and abolished

protection.

DISCUSSION

VII

127

Beclin 1

Class III PI3-K

3-MA,Wortmannin .

mTOR

Class I PI3-K

Rapamycin

Lysosome

Autophagolysosome

(3) (4)

(1)

(2)

AutophagosomePhagophore

PI3-P

Rab7 Bafilomycin A1

Ischemia ReperfusionAA, Serum deprivation

Bcl-2/-xL

FIG. 43. Autophagy in HL-1 cardiac myocytes. The main steps of the autophagic mechanism are (1) induction, (2) AV formation, (3) sequestration of cytoplasmic material, and (4) degradation of the AVs and cargo by lysosomal proteases (see Fig. 3, 5). Nutrient (amino acid, AA; serum) deprivation strongly activated autophagic flux. During ischemia, autophagy was inhibited at the level of autophagosome formation. Upon reperfusion, autophagy partially recovered, with submaximal induction and impaired degradation. Enhancing autophagic flux was protective against sI/R injury. Interestingly, Beclin1 enhanced autophagic flux by increasing lysosomal degradation of AVs, supporting a suggested role in lysosomal protein sorting.

VII-4 Chapter VI: Nature of protection exerted by autophagy: role of

mitophagy

In Chapter III we determined that sI/R in HL-1 cardiac myocytes leads to mitochondrial

stress, reflected by loss of ∆Ψm, increased ROS generation, and fragmentation of

mitochondria. In addition, sI/R injury culminates in Bax redistribution and cell death,

revealing the execution of the mitochondrial apoptotic pathway. In Chapter V we

determined that autophagy constitutes an underlying protective response against

mitochondrial apoptotic I/R injury in cardiac myocytes. Based on our findings we

refined our original hypothesis, and in Chapter VI sought to test whether the protection

exerted by autophagy is in part due to the degradation of malfunctioning mitochondria.

DISCUSSION

VII

128

VII-4.1 Autophagic scavenging of mitochondria (mitophagy) during sI/R

High-resolution fluorescence microscopy of mito-DsRed2-labeled mitochondria and

GFP-LC3-labeled AVs revealed autophagic sequestration of mitochondrial fragments

early in the reperfusion period. Mitophagy has been reported to occur in the in vivo

heart: Electron microscopy studies detected mitophagy in the perfused rabbit heart model

following a mild hypoxic insult (Decker et al., 1980; Decker and Wildenthal, 1980).

Destabilized mitochondria can be removed through the process of mitophagy:

mitochondria are sequestered by autophagosomes, which then deliver the mitochondria to

the lysosomes where they are degraded. Mitophagy is a normal cell function to replace

‘old’ mitochondria, and in the heart mitochondrial turnover has been clocked at 6-10 days

(Moreau et al., 2005). Tight control of the cell’s mitochondrial population is necessary, as

mitochondria are important sources of ROS (Boveris et al., 1972) due to their high

oxidative capacity consequent to meeting the extreme energetic demands of the cardiac

myocyte. Mitochondria are also ROS-excitable organelles, amplifying internal or

external ROS signals at the electron transport chain (Huser et al., 1998; Leach et al.,

2001; Brady et al., 2004), a phenomenon termed ROS-induced ROS release (Zorov et al.,

2000). As such, mitochondria are not only a target of oxidative damage but also the most

important source of oxidative stress to neighboring components of the cell, resulting in

high levels of oxidative damage to proteins, lipids and mtDNA. This ‘vicious cycle’ is

thought to contribute to I/R injury ((Juhaszova et al., 2004) and aging (Lakatta and

Sollott, 2002). Mitophagy may function during myocardial I/R injury as a means to

eliminate mitochondria which are destructive (e.g. generating ROS, releasing pro-

apoptotic molecules), thus modulating the threshold for PCD.

VII-4.2 Bnip3 and activation of the sI/R apoptotic pathway

We recently determined that Bnip3 is a major contributor to I/R injury in the ex vivo heart

via disruption of mitochondrial integrity, leading to enhanced superoxide production and

the release of pro-apoptotic factors such as cytochrome c and AIF (Hamacher-Brady et

al., 2006). In our HL-1 cardiac myocytes model, overexpression of Bnip3 was used to

mimic I/R-induced mitochondrial dysfunction in a setting in which primary causative

factors of ischemia are not in place, i.e. in nutrient and oxygen rich conditions.

DISCUSSION

VII

129

Consistent with a role in I/R-induced mitochondrial dysfunction and cell death in the ex

vivo heart, RNAi knockdown of Bnip3 decreased sI/R-mediated Bax activation.

VII-4.2.1 Bnip3, mitochondrial fragmentation, and autophagy

Similar to sI/R, Bnip3 caused extensive fragmentation of the mitochondrial network,

which correlated with an upregulation of autophagy. We identified fragmented

mitochondria inside the autophagosomes, suggesting that autophagy serves as a

protective response to remove damaged mitochondria that may be harmful to the cell. We

found that mitophagy targeted previously fragmented mitochondria and that sI/R-induced

mitochondrial fragmentation was mediated by Drp1 (III-2.1). As enforced fragmentation

prior to sI/R via overexpression of Drp1 was protective against sI/R (III-5), we

hypothesize that Drp1-mediated mitochondrial fragmentation is a prerequisite for the

scavenging of damaged mitochondria via mitophagy. A recent report by Arnoult et al. on

Drp1 and mitochondrial elimination during PCD adds new evidence to this hypothesis

(Arnoult et al., 2005).

VII-4.2.2 Autophagy protects against Bnip3 apoptotic signaling

We determined that the increase in autophagic activity was a protective response against

Bnip3-mediated cell death. Similar to the findings in sI/R, Beclin1 overexpression

protected against, while Atg5K130R

aggravated, Bnip3-induced cell death. However,

opposed to the findings in sI/R, Beclin1∆Bcl2BD massively aggravated and Atg5

overexpression protected against Bnip3-induced cell death. These data indicate that

Bnip3-induced death is counteracted by on both signaling (Beclin1) and machinery level

(Atg5) functional autophagy.

Together, these results further support the notion that mitophagy during

reperfusion is specific to sI/R signaling pathways and that autophagy is a cytoprotective

mechanism that is capable of reducing sI/R-induced damage. Furthermore, Bnip3 exerts

its toxicity by causing mitochondrial dysfunction indicating that autophagy protects

against sI/R injury by removing pro-apoptotic mitochondria.

VII-4.2.3 Signal for mitophagy?

It is not known whether Bnip3 activates the autophagic machinery directly or whether

autophagy is induced as a consequence of mitochondrial damage caused by Bnip3.

DISCUSSION

VII

130

Several studies have reported that overexpression of Bnip3 induces cell death through

MPTP opening (Vande Velde et al., 2000). Previous work has shown that the MPTP

serves as an upstream signal for mitochondrial autophagy (Elmore et al., 2001). The

MPTP has also been reported to play a role in I/R injury (Borutaite et al., 2003;

Hausenloy et al., 2003; Weiss et al., 2003), as well as in our of model of sI/R (III-3.2).

Activation of the MPTP causes collapse of ∆Ψm, the driving force for ATP synthesis,

leading us to speculate that a change in ATP:AMP may be a signaling mechanism for

autophagy. AMPK, which functions as a sensor for the intracellular energetic state, is

strongly and immediately upregulated by uncoupling of oxidative phosphorylation

(Soltoff, 2004) and can inactivate p70S6 kinase, the downstream mediator of mTOR

(Tokunaga et al., 2004). As mTOR has been reported to be localized in part to

mitochondria (Desai et al., 2002), an mTOR-AMPK interaction may govern local

selective removal of mitochondria.

VII-4.3 Conclusions

In summary, our results suggest that mitophagy is a crucial mechanism that allows the

cell to eliminate the most harmful mitochondria, thus modulating the threshold for the

onset of PCD. We propose that by removing a more susceptible subpopulation of pro-

apoptotic mitochondria responsible for local ROS generation and release of pro-apoptotic

factors the cell can prevent the recruitment of the entire mitochondrial population to the

execution of the cell death program (Lemasters et al., 1998; Skulachev, 2000).

VII-5 Perspectives: Significance in the heart

The body of work presented in this thesis demonstrates for the first time that autophagy

constitutes an underlying protective response against I/R injury in heart cells. Future

experiments are needed to determine whether autophagy, and specifically mitophagy,

represents a means to reduce cardiac I/R injury in vivo.

Clearly, establishing the mechanisms which promote the anti-apoptotic effects of

autophagy, and minimize autophagic cell death may represent a potentially powerful tool

against I/R-activated cardiac myocyte cell death. Although cell models are useful for

identifying participants and their roles in the control of autophagy over cell death, ex vivo

DISCUSSION

VII

131

and in vivo models of autophagy must be developed to determine the relevance in the

heart. PI3-K inhibitors do not discriminate between different classes of PI3-K. Long-

term administration of 3-MA toxic in heart cells (Terman et al., 2003) and furthermore,

wortmannin has been shown to inhibit class I PI3-K/Akt-dependent pro-survival

pathways in myocardial I/R injury (Tsang et al., 2004). Likewise, rapamycin, which has

been shown to be protective in neurons (Ravikumar et al., 2006), may not be acceptable

to treat the heart as it inhibits Hif-1-alpha and thus would block Hif1alpha-mediated

protective responses (Cai et al., 2003). Thus, classic means to perturb the autophagic

pathway are not ideal for studies in the heart.

TAT-mediated protein transduction which has proven useful for introducing

protective proteins to the heart, in vivo and ex vivo (Gustafsson et al., 2002; Inagaki et al.,

2003) will likely be a useful tool to dissect the role of autophagy in the heart. Our lab has

shown that proteins fused to the protein transduction domain of HIV TAT, an

amphiphatic 11 amino acid sequence can be transduced across the plasma membrane in

large quantities in the heart. TAT-fusion proteins used to introduce ARC and Bnip3∆TM

provided significant protection against I/R injury and improved cardiac function. Based

on the results of this thesis, Beclin1, Atg5 and Atg5K130R

are interesting candidates for

TAT studies.

Our method of systematically distinguishing AV content from autophagic activity,

i.e. the flux of AV formation and degradation, using lysosomal inhibition has the

potential to redefine previous reports concerning autophagy in the heart and other

models. The combination of lysosomal inhibitors and TAT-fusion proteins in the ex vivo

heart of transgenic GFP-LC3 mice (Kirisako et al., 1999; Mizushima et al., 2004) is

likely to give powerful insights into the role of autophagy in the heart.

SUMMARY

VIII

133

VIII Summary

Apoptotic cell death of cardiac myocytes contributes to cardiovascular disease. Increased

levels of autophagosomes have been reported during myocardial ischemia/reperfusion

(I/R) injury, however, whether autophagy functions as a protective or lethal response is

unclear. The overall goal of this thesis was to elucidate the nature of the relationship

between I/R-activated mitochondrial (apoptotic) death pathways and autophagy.

Apoptotic and autophagic signaling pathways were systematically perturbed to determine

cause and effect relationships. High-resolution fluorescence imaging was employed to

quantify spatial and temporal events in the single cell.

In Chapter III, we developed a cell culture-based model of simulated I/R (sI/R)

injury which closely matches the in vivo situation, using the HL-1 cardiac myocyte cell

line, specific fluorescent dyes, GFP-fusion proteins, and multidimensional fluorescence

deconvolution microscopy. During ischemia, which was simulated using a hypoxic,

glucose-free, acidic solution, mitochondrial networks fragmented. Bax translocation

from the cytosol to mitochondria was initiated during ischemia and continued during

reperfusion. However, subsequent clustering (activation) of Bax at mitochondria

occurred late into reperfusion. Enforced mitochondrial fragmentation by expression of

Drp1 reduced Bax clustering, indicating that fragmentation was a protective response.

Bid processing was caspase 8 dependent, and Bid translocation to mitochondria occurred

after Bax translocation and clustering, and shortly before cell death. Clustering of Bax

was prevented by anti-apoptotic Bcl-2 and Bcl-xL, cyclosporine A, an inhibitor of the

mitochondrial permeability transition pore, and also by SB203580, an inhibitor of p38

MAPK. Surprisingly, mitochondrial fragmentation could be reversed by the addition of

the p38 inhibitor SB203580 at reperfusion, implicating p38 MAPK in the mitochondrial

remodeling response to I/R that facilitates Bax recruitment to mitochondria.

Apoptotic and autophagic pathways are linked through the interaction of anti-

apoptotic Bcl-2 proteins with the autophagy protein Beclin1. However, the nature of the

interaction, either in promoting or blocking autophagy remains unclear. In Chapter IV

we developed a highly-sensitive, macroautophagy-specific methodology: to quantify

nutrient-deprivation-activated autophagic flux by comparing levels of GFP-LC3 labeled

autophagosomes under steady-state conditions and in the presence of lysosomal

SUMMARY

VIII

134

inhibitors. Expression of Beclin1 lacking the Bcl-2 binding domain (Beclin1∆Bcl2BD)

significantly reduced autophagic flux, indicating that Beclin1-mediated autophagy

requires an interaction with Bcl-2. In apparent contrast, overexpression of Bcl-2 slightly

suppressed autophagic flux; this effect was enhanced by targeting Bcl-2 to the

sarco/endoplasmic reticulum (S/ER). The suppressive effect on autophagy by S/ER-

targeted Bcl-2 may be in part due to the depletion of S/ER calcium stores: intracellular

scavenging of calcium by BAPTA-AM and treatment with thapsigargin, an inhibitor of

the S/ER calcium ATPase (SERCA; pumps calcium from the cytosol into the S/ER),

significantly reduced autophagic activity. These findings demonstrate that Bcl-2

regulates the autophagic response at the level of S/ER calcium content rather than via

direct interaction with Beclin1. Moreover, calcium homeostasis was identified as an

essential component of the autophagic response to nutrient deprivation.

Subsequently, in Chapter V, the dynamics and role of autophagy during sI/R were

investigated. Autophagic flux was null during the ischemic period, and increased at

reperfusion, but not to the same degree as under normoxic conditions. We found that

sI/R impaired both formation and downstream lysosomal degradation of

autophagosomes. Both rapamycin and overexpression of Beclin1 enhanced autophagic

flux following sI/R and significantly reduced activation of Bax, while 3-MA,

wortmannin, and RNAi knockdown of Beclin1 increased Bax activation. Expression of

Beclin1∆Bcl2BD resulted in decreased autophagic flux and did not protect against Bax-

activation and the expression of a dominant negative mutant of Atg5, a component of the

autophagosomal machinery downstream of Beclin1, increased Bax activation. These

results demonstrate that autophagic flux is impaired at the level of both induction and

degradation. Residual levels of autophagy, even though not maximal, functioned to

preserve cell viability following sI/R and enhancing autophagy constituted a powerful

and previously uncharacterized protective mechanism against I/R injury to the heart cell.

In Chapter VI, using high-resolution imaging we found that during sI/R

fragmented mitochondria were frequently sequestered by autophagosomes (mitophagy).

To investigate the connection between sI/R-induced mitochondrial dysfunction and

autophagy we focused on Bnip3, a mitochondrial pro-apoptotic Bcl-2 family member

which mediates I/R-induced mitochondrial dysfunction in the heart and has been shown

SUMMARY

VIII

135

to activate autophagy. RNAi knockdown identified Bnip3 as an important mediator of

sI/R injury in HL-1 cells. Overexpression of Bnip3, to simulate a specific and necessary

event in I/R-activated mitochondrial dysfunction, induced fragmentation of the

mitochondrial network and cell death in the absence of sI/R. Moreover, Bnip3

expression enhanced both steady-state levels of AVs and autophagic flux. Many of the

Bnip3-induced autophagosomes contained fragmented mitochondria. Overexpression of

both Beclin1 and Atg5 protected against Bnip3-mediated cell death, while blocking

autophagy with dominant negative mutants of Beclin1 or Atg5 enhanced cell death.

These findings indicate that the autophagic pathway opposes the mitochondrial apoptotic

pathway, in that autophagy of dysfunctional mitochondria counteracts Bnip3-mediated

mitochondrial death signaling. We hypothesize that, likewise, autophagy protects against

myocardial I/R injury via the removal of damaged mitochondria.

REFERENCES

IX

137

IX References

Abramoff, M. D. and M. A. Viergever (2002). "Computation and visualization of three-

dimensional soft tissue motion in the orbit." IEEE Trans Med Imaging 21(4): 296-304.

Acehan, D., X. Jiang, D. G. Morgan, J. E. Heuser, X. Wang and C. W. Akey (2002). "Three-

dimensional structure of the apoptosome: implications for assembly, procaspase-9

binding, and activation." Mol Cell 9(2): 423-32.

Adlam, V. J., J. C. Harrison, C. M. Porteous, A. M. James, R. A. Smith, M. P. Murphy and I. A.

Sammut (2005). "Targeting an antioxidant to mitochondria decreases cardiac ischemia-

reperfusion injury." Faseb J 19(9): 1088-95.

Akao, M., B. O'Rourke, Y. Teshima, J. Seharaseyon and E. Marban (2003). "Mechanistically

distinct steps in the mitochondrial death pathway triggered by oxidative stress in cardiac

myocytes." Circ Res 92(2): 186-94.

Akazawa, H., S. Komazaki, H. Shimomura, F. Terasaki, Y. Zou, H. Takano, T. Nagai and I.

Komuro (2004). "Diphtheria toxin-induced autophagic cardiomyocyte death plays a

pathogenic role in mouse model of heart failure." J Biol Chem 279(39): 41095-103.

Altschul, S. F., W. Gish, W. Miller, E. W. Myers and D. J. Lipman (1990). "Basic local

alignment search tool." J Mol Biol 215(3): 403-10.

Amarzguioui, M., J. J. Rossi and D. Kim (2005). "Approaches for chemically synthesized siRNA

and vector-mediated RNAi." FEBS Lett 579(26): 5974-81.

Ambrosio, G., J. L. Zweier, C. Duilio, P. Kuppusamy, G. Santoro, P. P. Elia, I. Tritto, P. Cirillo,

M. Condorelli, M. Chiariello and et al. (1993). "Evidence that mitochondrial respiration

is a source of potentially toxic oxygen free radicals in intact rabbit hearts subjected to

ischemia and reflow." J Biol Chem 268(25): 18532-41.

Antonsson, B. (2004). "Mitochondria and the Bcl-2 family proteins in apoptosis signaling

pathways." Mol Cell Biochem 256-257(1-2): 141-55.

Anversa, P., A. Leri and J. Kajstura (2006). "Cardiac regeneration." J Am Coll Cardiol 47(9):

1769-76.

Aplin, A., T. Jasionowski, D. L. Tuttle, S. E. Lenk and W. A. Dunn, Jr. (1992). "Cytoskeletal

elements are required for the formation and maturation of autophagic vacuoles." J Cell

Physiol 152(3): 458-66.

Arcaro, A. and M. P. Wymann (1993). "Wortmannin is a potent phosphatidylinositol 3-kinase

inhibitor: the role of phosphatidylinositol 3,4,5-trisphosphate in neutrophil responses."

Biochem J 296 ( Pt 2): 297-301.

Arnoult, D., N. Rismanchi, A. Grodet, R. G. Roberts, D. P. Seeburg, J. Estaquier, M. Sheng and

C. Blackstone (2005). "Bax/Bak-dependent release of DDP/TIMM8a promotes Drp1-

mediated mitochondrial fission and mitoptosis during programmed cell death." Curr Biol

15(23): 2112-8.

Ashkenazi, A. and V. M. Dixit (1998). "Death receptors: signaling and modulation." Science

281(5381): 1305-8.

Bagchi, D., G. J. Wetscher, M. Bagchi, P. R. Hinder, G. Perdikis, S. J. Stohs, R. A. Hinder and D.

K. Das (1997). "Interrelationship between cellular calcium homeostasis and free radical

generation in myocardial reperfusion injury." Chem Biol Interact 104(2-3): 65-85.

Baines, C. P., R. A. Kaiser, N. H. Purcell, N. S. Blair, H. Osinska, M. A. Hambleton, E. W.

Brunskill, M. R. Sayen, R. A. Gottlieb, G. W. Dorn, J. Robbins and J. D. Molkentin

(2005). "Loss of cyclophilin D reveals a critical role for mitochondrial permeability

transition in cell death." Nature 434(7033): 658-62.

Beham, A., M. C. Marin, A. Fernandez, J. Herrmann, S. Brisbay, A. M. Tari, G. Lopez-Berestein,

G. Lozano, M. Sarkiss and T. J. McDonnell (1997). "Bcl-2 inhibits p53 nuclear import

following DNA damage." Oncogene 15(23): 2767-72.

REFERENCES

IX

138

Bernardi, P., V. Petronilli, F. Di Lisa and M. Forte (2001). "A mitochondrial perspective on cell

death." Trends Biochem Sci 26(2): 112-7.

Bernardi, P., L. Scorrano, R. Colonna, V. Petronilli and F. Di Lisa (1999). "Mitochondria and cell

death. Mechanistic aspects and methodological issues." Eur J Biochem 264(3): 687-701.

Bers, D. M. (2000). "Calcium fluxes involved in control of cardiac myocyte contraction." Circ

Res 87(4): 275-81.

Blankson, H., I. Holen and P. O. Seglen (1995). "Disruption of the cytokeratin cytoskeleton and

inhibition of hepatocytic autophagy by okadaic acid." Exp Cell Res 218(2): 522-30.

Blommaart, E. F., U. Krause, J. P. Schellens, H. Vreeling-Sindelarova and A. J. Meijer (1997).

"The phosphatidylinositol 3-kinase inhibitors wortmannin and LY294002 inhibit

autophagy in isolated rat hepatocytes." Eur J Biochem 243(1-2): 240-6.

Blommaart, E. F., J. J. Luiken, P. J. Blommaart, G. M. van Woerkom and A. J. Meijer (1995).

"Phosphorylation of ribosomal protein S6 is inhibitory for autophagy in isolated rat

hepatocytes." J Biol Chem 270(5): 2320-6.

Bond, J. M., B. Herman and J. J. Lemasters (1991). "Recovery of cultured rat neonatal myocytes

from hypercontracture after chemical hypoxia." Res Commun Chem Pathol Pharmacol

71(2): 195-208.

Borutaite, V., A. Jekabsone, R. Morkuniene and G. C. Brown (2003). "Inhibition of

mitochondrial permeability transition prevents mitochondrial dysfunction, cytochrome c

release and apoptosis induced by heart ischemia." J Mol Cell Cardiol 35(4): 357-66.

Boveris, A., N. Oshino and B. Chance (1972). "The cellular production of hydrogen peroxide."

Biochem J 128(3): 617-30.

Boya, P., R. A. Gonzalez-Polo, N. Casares, J. L. Perfettini, P. Dessen, N. Larochette, D. Metivier,

D. Meley, S. Souquere, T. Yoshimori, G. Pierron, P. Codogno and G. Kroemer (2005).

"Inhibition of macroautophagy triggers apoptosis." Mol Cell Biol 25(3): 1025-40.

Brady, N. R., S. P. Elmore, J. J. van Beek, K. Krab, P. J. Courtoy, L. Hue and H. V. Westerhoff

(2004). "Coordinated behavior of mitochondria in both space and time: a reactive oxygen

species-activated wave of mitochondrial depolarization." Biophys J 87(3): 2022-34.

Breckenridge, D. G., M. Germain, J. P. Mathai, M. Nguyen and G. C. Shore (2003). "Regulation

of apoptosis by endoplasmic reticulum pathways." Oncogene 22(53): 8608-18.

Brocheriou, V., A. A. Hagege, A. Oubenaissa, M. Lambert, V. O. Mallet, M. Duriez, M. Wassef,

A. Kahn, P. Menasche and H. Gilgenkrantz (2000). "Cardiac functional improvement by

a human Bcl-2 transgene in a mouse model of ischemia/reperfusion injury." J Gene Med

2(5): 326-33.

Bruick, R. K. (2000). "Expression of the gene encoding the proapoptotic Nip3 protein is induced

by hypoxia." Proc Natl Acad Sci U S A 97(16): 9082-7.

Brunk, U. T. and A. Terman (2002). "The mitochondrial-lysosomal axis theory of aging:

accumulation of damaged mitochondria as a result of imperfect autophagocytosis." Eur J

Biochem 269(8): 1996-2002.

Brunn, G. J., J. Williams, C. Sabers, G. Wiederrecht, J. C. Lawrence, Jr. and R. T. Abraham

(1996). "Direct inhibition of the signaling functions of the mammalian target of

rapamycin by the phosphoinositide 3-kinase inhibitors, wortmannin and LY294002."

Embo J 15(19): 5256-67.

Bucci, C., P. Thomsen, P. Nicoziani, J. McCarthy and B. van Deurs (2000). "Rab7: a key to

lysosome biogenesis." Mol Biol Cell 11(2): 467-80.

Bursch, W. (2001). "The autophagosomal-lysosomal compartment in programmed cell death."

Cell Death Differ 8(6): 569-81.

Cai, Z., D. J. Manalo, G. Wei, E. R. Rodriguez, K. Fox-Talbot, H. Lu, J. L. Zweier and G. L.

Semenza (2003). "Hearts from rodents exposed to intermittent hypoxia or erythropoietin

are protected against ischemia-reperfusion injury." Circulation 108(1): 79-85.

REFERENCES

IX

139

Calvillo, L., S. Masson, M. Salio, L. Pollicino, N. De Angelis, F. Fiordaliso, A. Bai, P. Ghezzi, F.

Santangelo and R. Latini (2003). "In vivo cardioprotection by N-acetylcysteine and

isosorbide 5-mononitrate in a rat model of ischemia-reperfusion." Cardiovasc Drugs Ther

17(3): 199-208.

Canu, N., R. Tufi, A. L. Serafino, G. Amadoro, M. T. Ciotti and P. Calissano (2005). "Role of the

autophagic-lysosomal system on low potassium-induced apoptosis in cultured cerebellar

granule cells." J Neurochem 92(5): 1228-42.

Capano, M. and M. Crompton (2002). "Biphasic translocation of Bax to mitochondria." Biochem

J 367(Pt 1): 169-78.

Caro, L. H., P. J. Plomp, E. J. Wolvetang, C. Kerkhof and A. J. Meijer (1988). "3-Methyladenine,

an inhibitor of autophagy, has multiple effects on metabolism." Eur J Biochem 175(2):

325-9.

Chami, M., A. Prandini, M. Campanella, P. Pinton, G. Szabadkai, J. C. Reed and R. Rizzuto

(2004). "Bcl-2 and Bax exert opposing effects on Ca2+ signaling, which do not depend

on their putative pore-forming region." J Biol Chem 279(52): 54581-9.

Chang, L., S. H. Chiang and A. R. Saltiel (2004). "Insulin signaling and the regulation of glucose

transport." Mol Med 10(7-12): 65-71.

Chen, G., R. Ray, D. Dubik, L. Shi, J. Cizeau, R. C. Bleackley, S. Saxena, R. D. Gietz and A. H.

Greenberg (1997). "The E1B 19K/Bcl-2-binding protein Nip3 is a dimeric mitochondrial

protein that activates apoptosis." J Exp Med 186(12): 1975-83.

Chen, M., H. He, S. Zhan, S. Krajewski, J. C. Reed and R. A. Gottlieb (2001). "Bid is cleaved by

calpain to an active fragment in vitro and during myocardial ischemia/reperfusion." J Biol

Chem 276(33): 30724-8.

Chen, M., D. J. Won, S. Krajewski and R. A. Gottlieb (2002). "Calpain and mitochondria in

ischemia/reperfusion injury." J Biol Chem 277(32): 29181-6.

Cheng, E. H., M. C. Wei, S. Weiler, R. A. Flavell, T. W. Mak, T. Lindsten and S. J. Korsmeyer

(2001). "BCL-2, BCL-X(L) sequester BH3 domain-only molecules preventing BAX- and

BAK-mediated mitochondrial apoptosis." Mol Cell 8(3): 705-11.

Chinnaiyan, A. M., K. O'Rourke, M. Tewari and V. M. Dixit (1995). "FADD, a novel death

domain-containing protein, interacts with the death domain of Fas and initiates

apoptosis." Cell 81(4): 505-12.

Cirman, T., K. Oresic, G. D. Mazovec, V. Turk, J. C. Reed, R. M. Myers, G. S. Salvesen and B.

Turk (2004). "Selective disruption of lysosomes in HeLa cells triggers apoptosis

mediated by cleavage of Bid by multiple papain-like lysosomal cathepsins." J Biol Chem

279(5): 3578-87.

Claycomb, W. C., N. A. Lanson, Jr., B. S. Stallworth, D. B. Egeland, J. B. Delcarpio, A. Bahinski

and N. J. Izzo, Jr. (1998). "HL-1 cells: a cardiac muscle cell line that contracts and retains

phenotypic characteristics of the adult cardiomyocyte." Proc Natl Acad Sci U S A 95(6):

2979-84.

Codogno, P. and A. J. Meijer (2005). "Autophagy and signaling: their role in cell survival and

cell death." Cell Death Differ 12 Suppl 2: 1509-18.

Collins, T. J., M. J. Berridge, P. Lipp and M. D. Bootman (2002). "Mitochondria are

morphologically and functionally heterogeneous within cells." Embo J 21(7): 1616-27.

Cory, S. and J. M. Adams (2002). "The Bcl2 family: regulators of the cellular life-or-death

switch." Nat Rev Cancer 2(9): 647-56.

CPMB Current Protocols in Molecular Biology, John Wiley & Sons.

Crompton, M. (2000). "Mitochondrial intermembrane junctional complexes and their role in cell

death." J Physiol 529 Pt 1: 11-21.

Crow, M. T., K. Mani, Y. J. Nam and R. N. Kitsis (2004). "The mitochondrial death pathway and

cardiac myocyte apoptosis." Circ Res 95(10): 957-70.

REFERENCES

IX

140

Cuervo, A. M. (2004). "Autophagy: many paths to the same end." Mol Cell Biochem 263(1-2):

55-72.

Cuervo, A. M. and J. F. Dice (1996). "A receptor for the selective uptake and degradation of

proteins by lysosomes." Science 273(5274): 501-3.

Daido, S., T. Kanzawa, A. Yamamoto, H. Takeuchi, Y. Kondo and S. Kondo (2004). "Pivotal

role of the cell death factor BNIP3 in ceramide-induced autophagic cell death in

malignant glioma cells." Cancer Res 64(12): 4286-93.

De Giorgi, F., L. Lartigue, M. K. Bauer, A. Schubert, S. Grimm, G. T. Hanson, S. J. Remington,

R. J. Youle and F. Ichas (2002). "The permeability transition pore signals apoptosis by

directing Bax translocation and multimerization." Faseb J 16(6): 607-9.

Decker, R. S., A. R. Poole, J. S. Crie, J. T. Dingle and K. Wildenthal (1980). "Lysosomal

alterations in hypoxic and reoxygenated hearts. II. Immunohistochemical and

biochemical changes in cathepsin D." Am J Pathol 98(2): 445-56.

Decker, R. S. and K. Wildenthal (1980). "Lysosomal alterations in hypoxic and reoxygenated

hearts. I. Ultrastructural and cytochemical changes." Am J Pathol 98(2): 425-44.

Degli Esposti, M. (2002). "Measuring mitochondrial reactive oxygen species." Methods 26(4):

335-40.

Depre, C., S. J. Kim, A. S. John, Y. Huang, O. E. Rimoldi, J. R. Pepper, G. D. Dreyfus, V.

Gaussin, D. J. Pennell, D. E. Vatner, P. G. Camici and S. F. Vatner (2004). "Program of

cell survival underlying human and experimental hibernating myocardium." Circ Res

95(4): 433-40.

Desagher, S. and J. C. Martinou (2000). "Mitochondria as the central control point of apoptosis."

Trends Cell Biol 10(9): 369-77.

Desai, B. N., B. R. Myers and S. L. Schreiber (2002). "FKBP12-rapamycin-associated protein

associates with mitochondria and senses osmotic stress via mitochondrial dysfunction."

Proc Natl Acad Sci U S A 99(7): 4319-24.

Di Lisa, F. and P. Bernardi (1998). "Mitochondrial function as a determinant of recovery or death

in cell response to injury." Mol Cell Biochem 184(1-2): 379-91.

Dougherty, C. J., L. A. Kubasiak, H. Prentice, P. Andreka, N. H. Bishopric and K. A. Webster

(2002). "Activation of c-Jun N-terminal kinase promotes survival of cardiac myocytes

after oxidative stress." Biochem J 362(Pt 3): 561-71.

Dremina, E. S., V. S. Sharov, K. Kumar, A. Zaidi, E. K. Michaelis and C. Schoneich (2004).

"Anti-apoptotic protein Bcl-2 interacts with and destabilizes the

sarcoplasmic/endoplasmic reticulum Ca2+-ATPase (SERCA)." Biochem J 383(Pt 2):

361-70.

Du, C., M. Fang, Y. Li, L. Li and X. Wang (2000). "Smac, a mitochondrial protein that promotes

cytochrome c-dependent caspase activation by eliminating IAP inhibition." Cell 102(1):

33-42.

Duchen, M. R. (2000). "Mitochondria and Ca(2+)in cell physiology and pathophysiology." Cell

Calcium 28(5-6): 339-48.

Dunn, W. A., Jr. (1994). "Autophagy and related mechanisms of lysosome-mediated protein

degradation." Trends Cell Biol 4(4): 139-43.

Ellsworth, D. L., P. Sholinsky, C. Jaquish, R. R. Fabsitz and T. A. Manolio (1999). "Coronary

heart disease. At the interface of molecular genetics and preventive medicine." Am J Prev

Med 16(2): 122-33.

Elmore, S. P., T. Qian, S. F. Grissom and J. J. Lemasters (2001). "The mitochondrial permeability

transition initiates autophagy in rat hepatocytes." Faseb J 15(12): 2286-7.

Elsasser, A., A. M. Vogt, H. Nef, S. Kostin, H. Mollmann, W. Skwara, C. Bode, C. Hamm and J.

Schaper (2004). "Human hibernating myocardium is jeopardized by apoptotic and

autophagic cell death." J Am Coll Cardiol 43(12): 2191-9.

REFERENCES

IX

141

Eskelinen, E. L., C. K. Schmidt, S. Neu, M. Willenborg, G. Fuertes, N. Salvador, Y. Tanaka, R.

Lullmann-Rauch, D. Hartmann, J. Heeren, K. von Figura, E. Knecht and P. Saftig (2004).

"Disturbed cholesterol traffic but normal proteolytic function in LAMP-1/LAMP-2

double-deficient fibroblasts." Mol Biol Cell 15(7): 3132-45.

Eskes, R., S. Desagher, B. Antonsson and J. C. Martinou (2000). "Bid induces the

oligomerization and insertion of Bax into the outer mitochondrial membrane." Mol Cell

Biol 20(3): 929-35.

Feng, J., B. J. Schaus, J. A. Fallavollita, T. C. Lee and J. M. Canty, Jr. (2001). "Preload induces

troponin I degradation independently of myocardial ischemia." Circulation 103(16):

2035-7.

Finn, P. F. and J. F. Dice (2005). "Ketone bodies stimulate chaperone-mediated autophagy." J

Biol Chem 280(27): 25864-70.

Foyouzi-Youssefi, R., S. Arnaudeau, C. Borner, W. L. Kelley, J. Tschopp, D. P. Lew, N.

Demaurex and K. H. Krause (2000). "Bcl-2 decreases the free Ca2+ concentration within

the endoplasmic reticulum." Proc Natl Acad Sci U S A 97(11): 5723-8.

Frank, S., B. Gaume, E. S. Bergmann-Leitner, W. W. Leitner, E. G. Robert, F. Catez, C. L. Smith

and R. J. Youle (2001). "The role of dynamin-related protein 1, a mediator of

mitochondrial fission, in apoptosis." Dev Cell 1(4): 515-25.

Frieden, M., D. James, C. Castelbou, A. Danckaert, J. C. Martinou and N. Demaurex (2004).

"Ca(2+) homeostasis during mitochondrial fragmentation and perinuclear clustering

induced by hFis1." J Biol Chem 279(21): 22704-14.

George, M. D., M. Baba, S. V. Scott, N. Mizushima, B. S. Garrison, Y. Ohsumi and D. J.

Klionsky (2000). "Apg5p functions in the sequestration step in the cytoplasm-to-vacuole

targeting and macroautophagy pathways." Mol Biol Cell 11(3): 969-82.

Ghatan, S., S. Larner, Y. Kinoshita, M. Hetman, L. Patel, Z. Xia, R. J. Youle and R. S. Morrison

(2000). "p38 MAP Kinase Mediates Bax Translocation in Nitric Oxide-induced

Apoptosis in Neurons." J. Cell Biol. 150(2): 335-348.

Gonzalez-Polo, R. A., P. Boya, A. L. Pauleau, A. Jalil, N. Larochette, S. Souquere, E. L.

Eskelinen, G. Pierron, P. Saftig and G. Kroemer (2005a). "The apoptosis/autophagy

paradox: autophagic vacuolization before apoptotic death." J Cell Sci 118(Pt 14): 3091-

102.

Gonzalez-Polo, R. A., G. Carvalho, T. Braun, D. Decaudin, C. Fabre, N. Larochette, J. L.

Perfettini, M. Djavaheri-Mergny, I. Youlyouz-Marfak, P. Codogno, M. Raphael, J.

Feuillard and G. Kroemer (2005b). "PK11195 potently sensitizes to apoptosis induction

independently from the peripheral benzodiazepin receptor." Oncogene 24(51): 7503-13.

Goping, I. S., A. Gross, J. N. Lavoie, M. Nguyen, R. Jemmerson, K. Roth, S. J. Korsmeyer and

G. C. Shore (1998). "Regulated targeting of BAX to mitochondria." J Cell Biol 143(1):

207-15.

Gordon, P. B., I. Holen, M. Fosse, J. S. Rotnes and P. O. Seglen (1993). "Dependence of

hepatocytic autophagy on intracellularly sequestered calcium." J Biol Chem 268(35):

26107-12.

Gordon, P. B., H. Hoyvik and P. O. Seglen (1992). "Prelysosomal and lysosomal connections

between autophagy and endocytosis." Biochem J 283 ( Pt 2): 361-9.

Gottlieb, R. A. (2003). "Mitochondrial signaling in apoptosis: mitochondrial daggers to the

breaking heart." Basic Res Cardiol 98(4): 242-9.

Gottlieb, R. A. and R. L. Engler (1999). "Apoptosis in myocardial ischemia-reperfusion." Ann N

Y Acad Sci 874: 412-26.

Green, D. R. and J. C. Reed (1998). "Mitochondria and apoptosis." Science 281(5381): 1309-12.

Gross, E. R., A. K. Hsu and G. J. Gross (2004). "Opioid-induced cardioprotection occurs via

glycogen synthase kinase beta inhibition during reperfusion in intact rat hearts." Circ Res

94(7): 960-6.

REFERENCES

IX

142

Guicciardi, M. E., S. F. Bronk, N. W. Werneburg, X. M. Yin and G. J. Gores (2005). "Bid is

upstream of lysosome-mediated caspase 2 activation in tumor necrosis factor alpha-

induced hepatocyte apoptosis." Gastroenterology 129(1): 269-84.

Gustafsson, A. B. and R. A. Gottlieb (2003). "Mechanisms of apoptosis in the heart." J Clin

Immunol 23(6): 447-59.

Gustafsson, A. B., M. R. Sayen, S. D. Williams, M. T. Crow and R. A. Gottlieb (2002). "TAT

protein transduction into isolated perfused hearts: TAT-apoptosis repressor with caspase

recruitment domain is cardioprotective." Circulation 106(6): 735-9.

Gutierrez, M. G., S. S. Master, S. B. Singh, G. A. Taylor, M. I. Colombo and V. Deretic (2004a).

"Autophagy is a defense mechanism inhibiting BCG and Mycobacterium tuberculosis

survival in infected macrophages." Cell 119(6): 753-66.

Gutierrez, M. G., D. B. Munafo, W. Beron and M. I. Colombo (2004b). "Rab7 is required for the

normal progression of the autophagic pathway in mammalian cells." J Cell Sci 117(Pt

13): 2687-97.

Halestrap, A. P. (2006). "Calcium, mitochondria and reperfusion injury: a pore way to die."

Biochem Soc Trans 34(Pt 2): 232-7.

Halestrap, A. P., S. J. Clarke and S. A. Javadov (2004). "Mitochondrial permeability transition

pore opening during myocardial reperfusion--a target for cardioprotection." Cardiovasc

Res 61(3): 372-85.

Hamacher-Brady, A., N. R. Brady, S. E. Logue, M. R. Sayen, M. Jinno, L. A. Kirshenbaum, R.

A. Gottlieb and A. B. Gustafsson (2006). "Response to myocardial ischemia/reperfusion

injury involves Bnip3 and autophagy." Cell Death Differ.

Hanada, M., J. Feng and B. A. Hemmings (2004). "Structure, regulation and function of

PKB/AKT--a major therapeutic target." Biochim Biophys Acta 1697(1-2): 3-16.

Hausenloy, D. J., M. R. Duchen and D. M. Yellon (2003). "Inhibiting mitochondrial permeability

transition pore opening at reperfusion protects against ischaemia-reperfusion injury."

Cardiovasc Res 60(3): 617-25.

Heibein, J. A., I. S. Goping, M. Barry, M. J. Pinkoski, G. C. Shore, D. R. Green and R. C.

Bleackley (2000). "Granzyme B-mediated Cytochrome c Release Is Regulated by the

Bcl-2 Family Members Bid and Bax." J. Exp. Med. 192(10): 1391-1402.

Hein, S., E. Arnon, S. Kostin, M. Schonburg, A. Elsasser, V. Polyakova, E. P. Bauer, W. P.

Klovekorn and J. Schaper (2003). "Progression from compensated hypertrophy to failure

in the pressure-overloaded human heart: structural deterioration and compensatory

mechanisms." Circulation 107(7): 984-91.

Higuchi, R., B. Krummel and R. K. Saiki (1988). "A general method of in vitro preparation and

specific mutagenesis of DNA fragments: study of protein and DNA interactions." Nucleic

Acids Res 16(15): 7351-67.

Hochhauser, E., S. Kivity, D. Offen, N. Maulik, H. Otani, Y. Barhum, H. Pannet, V. Shneyvays,

A. Shainberg, V. Goldshtaub, A. Tobar and B. A. Vidne (2003). "Bax ablation protects

against myocardial ischemia-reperfusion injury in transgenic mice." Am J Physiol Heart

Circ Physiol 284(6): H2351-9.

Hollander, J. M., K. M. Lin, B. T. Scott and W. H. Dillmann (2003). "Overexpression of PHGPx

and HSP60/10 protects against ischemia/reoxygenation injury." Free Radic Biol Med

35(7): 742-51.

Honda, H. M., P. Korge and J. N. Weiss (2005). "Mitochondria and ischemia/reperfusion injury."

Ann N Y Acad Sci 1047: 248-58.

Horvath, J., U. P. Ketelsen, A. Geibel-Zehender, N. Boehm, H. Olbrich, R. Korinthenberg and H.

Omran (2003). "Identification of a novel LAMP2 mutation responsible for X-

chromosomal dominant Danon disease." Neuropediatrics 34(5): 270-3.

REFERENCES

IX

143

Hou, Q. and Y.-T. Hsu (2005). "Bax translocates from cytosol to mitochondria in cardiac cells

during apoptosis: development of a GFP-Bax-stable H9c2 cell line for apoptosis

analysis." Am J Physiol Heart Circ Physiol 289(1): H477-487.

Hoyer-Hansen, M., L. Bastholm, I. S. Mathiasen, F. Elling and M. Jaattela (2005). "Vitamin D

analog EB1089 triggers dramatic lysosomal changes and Beclin 1-mediated autophagic

cell death." Cell Death Differ 12(10): 1297-309.

Hsu, H., J. Xiong and D. V. Goeddel (1995). "The TNF receptor 1-associated protein TRADD

signals cell death and NF-kappa B activation." Cell 81(4): 495-504.

Huang, J., K. Nakamura, Y. Ito, T. Uzuka, M. Morikawa, S. Hirai, K. Tomihara, T. Tanaka, Y.

Masuta, K. Ishii, K. Kato and H. Hamada (2005). "Bcl-xL gene transfer inhibits Bax

translocation and prolongs cardiac cold preservation time in rats." Circulation 112(1): 76-

83.

Huser, J., C. E. Rechenmacher and L. A. Blatter (1998). "Imaging the permeability pore transition

in single mitochondria." Biophys J 74(4): 2129-37.

Huxley, R., S. Lewington and R. Clarke (2002). "Cholesterol, coronary heart disease and stroke: a

review of published evidence from observational studies and randomized controlled

trials." Semin Vasc Med 2(3): 315-23.

Ichimura, Y., T. Kirisako, T. Takao, Y. Satomi, Y. Shimonishi, N. Ishihara, N. Mizushima, I.

Tanida, E. Kominami, M. Ohsumi, T. Noda and Y. Ohsumi (2000). "A ubiquitin-like

system mediates protein lipidation." Nature 408(6811): 488-92.

Idziorek, T., J. Estaquier, F. De Bels and J. C. Ameisen (1995). "YOPRO-1 permits

cytofluorometric analysis of programmed cell death (apoptosis) without interfering with

cell viability." J Immunol Methods 185(2): 249-58.

Imahashi, K., M. D. Schneider, C. Steenbergen and E. Murphy (2004). "Transgenic expression of

Bcl-2 modulates energy metabolism, prevents cytosolic acidification during ischemia,

and reduces ischemia/reperfusion injury." Circ Res 95(7): 734-41.

Inagaki, K., H. S. Hahn, G. W. Dorn, 2nd and D. Mochly-Rosen (2003). "Additive protection of

the ischemic heart ex vivo by combined treatment with delta-protein kinase C inhibitor

and epsilon-protein kinase C activator." Circulation 108(7): 869-75.

Ingwall, J. (2002). ATP and the Heart. Boston, Kluwer Academic Publishers.

Jagasia, R., P. Grote, B. Westermann and B. Conradt (2005). "DRP-1-mediated mitochondrial

fragmentation during EGL-1-induced cell death in C. elegans." Nature 433(7027): 754-

60.

Jager, S., C. Bucci, I. Tanida, T. Ueno, E. Kominami, P. Saftig and E.-L. Eskelinen (2004). "Role

for Rab7 in maturation of late autophagic vacuoles." J Cell Sci 117(20): 4837-4848.

Juhasz, G. and T. P. Neufeld (2006). "Autophagy: a forty-year search for a missing membrane

source." PLoS Biol 4(2): e36.

Juhaszova, M., D. B. Zorov, S. H. Kim, S. Pepe, Q. Fu, K. W. Fishbein, B. D. Ziman, S. Wang,

K. Ytrehus, C. L. Antos, E. N. Olson and S. J. Sollott (2004). "Glycogen synthase kinase-

3beta mediates convergence of protection signaling to inhibit the mitochondrial

permeability transition pore." J Clin Invest 113(11): 1535-49.

Kabeya, Y., N. Mizushima, T. Ueno, A. Yamamoto, T. Kirisako, T. Noda, E. Kominami, Y.

Ohsumi and T. Yoshimori (2000). "LC3, a mammalian homologue of yeast Apg8p, is

localized in autophagosome membranes after processing." Embo J 19(21): 5720-8.

Kabeya, Y., N. Mizushima, A. Yamamoto, S. Oshitani-Okamoto, Y. Ohsumi and T. Yoshimori

(2004). "LC3, GABARAP and GATE16 localize to autophagosomal membrane

depending on form-II formation." J Cell Sci 117(Pt 13): 2805-12.

Kajstura, J., W. Cheng, K. Reiss, W. A. Clark, E. H. Sonnenblick, S. Krajewski, J. C. Reed, G.

Olivetti and P. Anversa (1996). "Apoptotic and necrotic myocyte cell deaths are

independent contributing variables of infarct size in rats." Lab Invest 74(1): 86-107.

REFERENCES

IX

144

Kanzawa, T., L. Zhang, L. Xiao, I. M. Germano, Y. Kondo and S. Kondo (2005). "Arsenic

trioxide induces autophagic cell death in malignant glioma cells by upregulation of

mitochondrial cell death protein BNIP3." Oncogene 24(6): 980-91.

Karbowski, M., Y. J. Lee, B. Gaume, S. Y. Jeong, S. Frank, A. Nechushtan, A. Santel, M. Fuller,

C. L. Smith and R. J. Youle (2002). "Spatial and temporal association of Bax with

mitochondrial fission sites, Drp1, and Mfn2 during apoptosis." J Cell Biol 159(6): 931-8.

Karwatowska-Prokopczuk, E., J. A. Nordberg, H. L. Li, R. L. Engler and R. A. Gottlieb (1998).

"Effect of vacuolar proton ATPase on pHi, Ca2+, and apoptosis in neonatal

cardiomyocytes during metabolic inhibition/recovery." Circ Res 82(11): 1139-44.

Kelekar, A. and C. B. Thompson (1998). "Bcl-2-family proteins: the role of the BH3 domain in

apoptosis." Trends Cell Biol 8(8): 324-30.

Kiffin, R., C. Christian, E. Knecht and A. M. Cuervo (2004). "Activation of chaperone-mediated

autophagy during oxidative stress." Mol Biol Cell 15(11): 4829-40.

Kihara, A., Y. Kabeya, Y. Ohsumi and T. Yoshimori (2001a). "Beclin-phosphatidylinositol 3-

kinase complex functions at the trans-Golgi network." EMBO Rep 2(4): 330-5.

Kihara, A., T. Noda, N. Ishihara and Y. Ohsumi (2001b). "Two distinct Vps34

phosphatidylinositol 3-kinase complexes function in autophagy and carboxypeptidase Y

sorting in Saccharomyces cerevisiae." J Cell Biol 152(3): 519-30.

Kim, J. and D. J. Klionsky (2000). "Autophagy, cytoplasm-to-vacuole targeting pathway, and

pexophagy in yeast and mammalian cells." Annu Rev Biochem 69: 303-42.

Kim, J. S., L. He and J. J. Lemasters (2003). "Mitochondrial permeability transition: a common

pathway to necrosis and apoptosis." Biochem Biophys Res Commun 304(3): 463-70.

Kim, J. S., Y. Jin and J. J. Lemasters (2006). "Reactive oxygen species, but not Ca2+, triger pH-

and mitochondrial permeability transition-dependent death of adult rat myocytes after

ischemia/reperfusion " Am J Physiol Heart Circ Physiol.

Kimura, H., K. Shintani-Ishida, M. Nakajima, S. Liu, K. Matsumoto and K. Yoshida (2006).

"Ischemic preconditioning or p38 MAP kinase inhibition attenuates myocardial TNF

alpha production and mitochondria damage in brief myocardial ischemia." Life Sci

78(17): 1901-10.

Kirisako, T., M. Baba, N. Ishihara, K. Miyazawa, M. Ohsumi, T. Yoshimori, T. Noda and Y.

Ohsumi (1999). "Formation process of autophagosome is traced with Apg8/Aut7p in

yeast." J Cell Biol 147(2): 435-46.

Kirisako, T., Y. Ichimura, H. Okada, Y. Kabeya, N. Mizushima, T. Yoshimori, M. Ohsumi, T.

Takao, T. Noda and Y. Ohsumi (2000). "The reversible modification regulates the

membrane-binding state of Apg8/Aut7 essential for autophagy and the cytoplasm to

vacuole targeting pathway." J Cell Biol 151(2): 263-76.

Klionsky, D. J. and S. D. Emr (2000). "Autophagy as a regulated pathway of cellular

degradation." Science 290(5497): 1717-21.

Knaapen, M. W., M. J. Davies, M. De Bie, A. J. Haven, W. Martinet and M. M. Kockx (2001).

"Apoptotic versus autophagic cell death in heart failure." Cardiovasc Res 51(2): 304-12.

Kochl, R., X. W. Hu, E. Y. Chan and S. A. Tooze (2006). "Microtubules facilitate

autophagosome formation and fusion of autophagosomes with endosomes." Traffic 7(2):

129-45.

Kothari, S., J. Cizeau, E. McMillan-Ward, S. J. Israels, M. Bailes, K. Ens, L. A. Kirshenbaum and

S. B. Gibson (2003). "BNIP3 plays a role in hypoxic cell death in human epithelial cells

that is inhibited by growth factors EGF and IGF." Oncogene 22(30): 4734-44.

Kouno, T., M. Mizuguchi, I. Tanida, T. Ueno, T. Kanematsu, Y. Mori, H. Shinoda, M. Hirata, E.

Kominami and K. Kawano (2005). "Solution Structure of Microtubule-associated Protein

Light Chain 3 and Identification of Its Functional Subdomains." J. Biol. Chem. 280(26):

24610-24617.

REFERENCES

IX

145

Krajewski, S., S. Tanaka, S. Takayama, M. J. Schibler, W. Fenton and J. C. Reed (1993).

"Investigation of the subcellular distribution of the bcl-2 oncoprotein: residence in the

nuclear envelope, endoplasmic reticulum, and outer mitochondrial membranes." Cancer

Res 53(19): 4701-14.

Kubasiak, L. A., O. M. Hernandez, N. H. Bishopric and K. A. Webster (2002). "Hypoxia and

acidosis activate cardiac myocyte death through the Bcl-2 family protein BNIP3." Proc

Natl Acad Sci U S A 99(20): 12825-30.

Kuma, A., M. Hatano, M. Matsui, A. Yamamoto, H. Nakaya, T. Yoshimori, Y. Ohsumi, T.

Tokuhisa and N. Mizushima (2004). "The role of autophagy during the early neonatal

starvation period." Nature 432(7020): 1032-6.

Laemmli, U. K. (1970). "Cleavage of structural proteins during the assembly of the head of

bacteriophage T4." Nature 227(5259): 680-5.

Lakatta, E. G. and S. J. Sollott (2002). "The "heartbreak" of older age." Mol Interv 2(7): 431-46.

Lamparska-Przybysz, M., B. Gajkowska and T. Motyl (2005). "Cathepsins and BID are involved

in the molecular switch between apoptosis and autophagy in breast cancer MCF-7 cells

exposed to camptothecin." J Physiol Pharmacol 56 Suppl 3: 159-79.

Leach, J. K., G. Van Tuyle, P. S. Lin, R. Schmidt-Ullrich and R. B. Mikkelsen (2001). "Ionizing

radiation-induced, mitochondria-dependent generation of reactive oxygen/nitrogen."

Cancer Res 61(10): 3894-901.

Lee, P., M. Sata, D. J. Lefer, S. M. Factor, K. Walsh and R. N. Kitsis (2003). "Fas pathway is a

critical mediator of cardiac myocyte death and MI during ischemia-reperfusion in vivo."

Am J Physiol Heart Circ Physiol 284(2): H456-63.

Lee, Y. J., S. Y. Jeong, M. Karbowski, C. L. Smith and R. J. Youle (2004). "Roles of the

mammalian mitochondrial fission and fusion mediators Fis1, Drp1, and Opa1 in

apoptosis." Mol Biol Cell 15(11): 5001-11.

Lefer, A. M., P. Tsao, N. Aoki and M. A. Palladino, Jr. (1990). "Mediation of cardioprotection by

transforming growth factor-beta." Science 249(4964): 61-4.

Lemasters, J. J. (2005). "Selective mitochondrial autophagy, or mitophagy, as a targeted defense

against oxidative stress, mitochondrial dysfunction, and aging." Rejuvenation Res 8(1):

3-5.

Lemasters, J. J., A. L. Nieminen, T. Qian, L. C. Trost, S. P. Elmore, Y. Nishimura, R. A. Crowe,

W. E. Cascio, C. A. Bradham, D. A. Brenner and B. Herman (1998). "The mitochondrial

permeability transition in cell death: a common mechanism in necrosis, apoptosis and

autophagy." Biochim Biophys Acta 1366(1-2): 177-96.

Levraut, J., H. Iwase, Z. H. Shao, T. L. Vanden Hoek and P. T. Schumacker (2003). "Cell death

during ischemia: relationship to mitochondrial depolarization and ROS generation." Am J

Physiol Heart Circ Physiol 284(2): H549-58.

Leyssens, A., A. V. Nowicky, L. Patterson, M. Crompton and M. R. Duchen (1996). "The

relationship between mitochondrial state, ATP hydrolysis, [Mg2+]i and [Ca2+]i studied

in isolated rat cardiomyocytes." J Physiol (Lond) 496(1): 111-128.

Li, H., H. Zhu, C. J. Xu and J. Yuan (1998). "Cleavage of BID by caspase 8 mediates the

mitochondrial damage in the Fas pathway of apoptosis." Cell 94(4): 491-501.

Liang, X. H., S. Jackson, M. Seaman, K. Brown, B. Kempkes, H. Hibshoosh and B. Levine

(1999). "Induction of autophagy and inhibition of tumorigenesis by beclin 1." Nature

402(6762): 672-6.

Liang, X. H., L. K. Kleeman, H. H. Jiang, G. Gordon, J. E. Goldman, G. Berry, B. Herman and B.

Levine (1998). "Protection against fatal Sindbis virus encephalitis by beclin, a novel Bcl-

2-interacting protein." J Virol 72(11): 8586-96.

Liang, X. H., J. Yu, K. Brown and B. Levine (2001). "Beclin 1 contains a leucine-rich nuclear

export signal that is required for its autophagy and tumor suppressor function." Cancer

Res 61(8): 3443-9.

REFERENCES

IX

146

Lim, M. L., M. G. Lum, T. M. Hansen, X. Roucou and P. Nagley (2002). "On the release of

cytochrome c from mitochondria during cell death signaling." J Biomed Sci 9(6 Pt 1):

488-506.

Lithgow, T., R. van Driel, J. F. Bertram and A. Strasser (1994). "The protein product of the

oncogene bcl-2 is a component of the nuclear envelope, the endoplasmic reticulum, and

the outer mitochondrial membrane." Cell Growth Differ 5(4): 411-7.

Lundberg, K. C. and L. I. Szweda (2004). "Initiation of mitochondrial-mediated apoptosis during

cardiac reperfusion." Arch Biochem Biophys 432(1): 50-7.

Lyamzaev, K. G., D. S. Izyumov, A. V. Avetisyan, F. Yang, O. Y. Pletjushkina and B. V.

Chernyak (2004). "Inhibition of mitochondrial bioenergetics: the effects on structure of

mitochondria in the cell and on apoptosis." Acta Biochim Pol 51(2): 553-62.

Maddaford, T. G., C. Hurtado, S. Sobrattee, M. P. Czubryt and G. N. Pierce (1999). "A model of

low-flow ischemia and reperfusion in single, beating adult cardiomyocytes." Am J

Physiol 277(2 Pt 2): H788-98.

Mandic, A., K. Viktorsson, L. Strandberg, T. Heiden, J. Hansson, S. Linder and M. C. Shoshan

(2002). "Calpain-mediated Bid cleavage and calpain-independent Bak modulation: two

separate pathways in cisplatin-induced apoptosis." Mol Cell Biol 22(9): 3003-13.

Marin, M. C., A. Fernandez, R. J. Bick, S. Brisbay, L. M. Buja, M. Snuggs, D. J. McConkey, A.

C. von Eschenbach, M. J. Keating and T. J. McDonnell (1996). "Apoptosis suppression

by bcl-2 is correlated with the regulation of nuclear and cytosolic Ca2+." Oncogene

12(11): 2259-66.

Marino, G., J. A. Uria, X. S. Puente, V. Quesada, J. Bordallo and C. Lopez-Otin (2003). "Human

Autophagins, a Family of Cysteine Proteinases Potentially Implicated in Cell

Degradation by Autophagy." J. Biol. Chem. 278(6): 3671-3678.

Massey, A. C., S. Kaushik, G. Sovak, R. Kiffin and A. M. Cuervo (2006). "Consequences of the

selective blockage of chaperone-mediated autophagy." Proc Natl Acad Sci U S A

103(15): 5805-10.

Miyata, S., G. Takemura, Y. Kawase, Y. Li, H. Okada, R. Maruyama, H. Ushikoshi, M. Esaki, H.

Kanamori, L. Li, Y. Misao, A. Tezuka, T. Toyo-Oka, S. Minatoguchi, T. Fujiwara and H.

Fujiwara (2006). "Autophagic cardiomyocyte death in cardiomyopathic hamsters and its

prevention by granulocyte colony-stimulating factor." Am J Pathol 168(2): 386-97.

Mizushima, N., T. Noda, T. Yoshimori, Y. Tanaka, T. Ishii, M. D. George, D. J. Klionsky, M.

Ohsumi and Y. Ohsumi (1998a). "A protein conjugation system essential for autophagy."

Nature 395(6700): 395-8.

Mizushima, N., H. Sugita, T. Yoshimori and Y. Ohsumi (1998b). "A new protein conjugation

system in human. The counterpart of the yeast Apg12p conjugation system essential for

autophagy." J Biol Chem 273(51): 33889-92.

Mizushima, N., A. Yamamoto, M. Hatano, Y. Kobayashi, Y. Kabeya, K. Suzuki, T. Tokuhisa, Y.

Ohsumi and T. Yoshimori (2001). "Dissection of autophagosome formation using Apg5-

deficient mouse embryonic stem cells." J Cell Biol 152(4): 657-68.

Mizushima, N., A. Yamamoto, M. Matsui, T. Yoshimori and Y. Ohsumi (2004). "In vivo analysis

of autophagy in response to nutrient starvation using transgenic mice expressing a

fluorescent autophagosome marker." Mol Biol Cell 15(3): 1101-11.

Moreau, R., B. T. Nguyen, C. E. Doneanu and T. M. Hagen (2005). "Reversal by aminoguanidine

of the age-related increase in glycoxidation and lipoxidation in the cardiovascular system

of Fischer 344 rats." Biochem Pharmacol 69(1): 29-40.

Mullis, K., F. Faloona, S. Scharf, R. Saiki, G. Horn and H. Erlich (1986). "Specific enzymatic

amplification of DNA in vitro: the polymerase chain reaction." Cold Spring Harb Symp

Quant Biol 51 Pt 1: 263-73.

Muzio, M., B. R. Stockwell, H. R. Stennicke, G. S. Salvesen and V. M. Dixit (1998). "An

induced proximity model for caspase-8 activation." J Biol Chem 273(5): 2926-30.

REFERENCES

IX

147

Nagai, T., K. Ibata, E. S. Park, M. Kubota, K. Mikoshiba and A. Miyawaki (2002). "A variant of

yellow fluorescent protein with fast and efficient maturation for cell-biological

applications." Nat Biotechnol 20(1): 87-90.

Narula, J., N. Haider, R. Virmani, T. G. DiSalvo, F. D. Kolodgie, R. J. Hajjar, U. Schmidt, M. J.

Semigran, G. W. Dec and B. A. Khaw (1996). "Apoptosis in myocytes in end-stage heart

failure." N Engl J Med 335(16): 1182-9.

Nechushtan, A., C. L. Smith, Y. T. Hsu and R. J. Youle (1999). "Conformation of the Bax C-

terminus regulates subcellular location and cell death." Embo J 18(9): 2330-41.

Nechushtan, A., C. L. Smith, I. Lamensdorf, S. H. Yoon and R. J. Youle (2001). "Bax and Bak

coalesce into novel mitochondria-associated clusters during apoptosis." J Cell Biol

153(6): 1265-76.

Neuspiel, M., R. Zunino, S. Gangaraju, P. Rippstein and H. McBride (2005). "Activated

mitofusin 2 signals mitochondrial fusion, interferes with Bax activation, and reduces

susceptibility to radical induced depolarization." J Biol Chem 280(26): 25060-70.

Nicholson, D. W., A. Ali, N. A. Thornberry, J. P. Vaillancourt, C. K. Ding, M. Gallant, Y.

Gareau, P. R. Griffin, M. Labelle, Y. A. Lazebnik and et al. (1995). "Identification and

inhibition of the ICE/CED-3 protease necessary for mammalian apoptosis." Nature

376(6535): 37-43.

Nixon, R. A., J. Wegiel, A. Kumar, W. H. Yu, C. Peterhoff, A. Cataldo and A. M. Cuervo (2005).

"Extensive involvement of autophagy in Alzheimer disease: an immuno-electron

microscopy study." J Neuropathol Exp Neurol 64(2): 113-22.

Noda, T. and Y. Ohsumi (1998). "Tor, a phosphatidylinositol kinase homologue, controls

autophagy in yeast." J Biol Chem 273(7): 3963-6.

Obara, K., T. Sekito and Y. Ohsumi (2006). "Assortment of Phosphatidylinositol 3-Kinase

Complexes--Atg14p Directs Association of Complex I to the Pre-autophagosomal

Structure in Saccharomyces cerevisiae." Mol Biol Cell 17(4): 1527-39.

Oldenburg, O., M. V. Cohen, D. M. Yellon and J. M. Downey (2002). "Mitochondrial K(ATP)

channels: role in cardioprotection." Cardiovasc Res 55(3): 429-37.

Olivetti, G., R. Abbi, F. Quaini, J. Kajstura, W. Cheng, J. A. Nitahara, E. Quaini, C. Di Loreto, C.

A. Beltrami, S. Krajewski, J. C. Reed and P. Anversa (1997). "Apoptosis in the failing

human heart." N Engl J Med 336(16): 1131-41.

Oltvai, Z. N., C. L. Milliman and S. J. Korsmeyer (1993). "Bcl-2 heterodimerizes in vivo with a

conserved homolog, Bax, that accelerates programmed cell death." Cell 74(4): 609-19.

Opie, L. (1998). Heart Physiology: From Cell to Circulation.

Page, E., L. P. McCallister and B. Power (1971). "Sterological measurements of cardiac

ultrastructures implicated in excitation-contraction coupling." Proc Natl Acad Sci U S A

68(7): 1465-6.

Paglin, S., N. Y. Lee, C. Nakar, M. Fitzgerald, J. Plotkin, B. Deuel, N. Hackett, M. McMahill, E.

Sphicas, N. Lampen and J. Yahalom (2005). "Rapamycin-sensitive pathway regulates

mitochondrial membrane potential, autophagy, and survival in irradiated MCF-7 cells."

Cancer Res 65(23): 11061-70.

Palmer, A. E., C. Jin, J. C. Reed and R. Y. Tsien (2004). "Bcl-2-mediated alterations in

endoplasmic reticulum Ca2+ analyzed with an improved genetically encoded fluorescent

sensor." Proc Natl Acad Sci U S A 101(50): 17404-9.

Pattingre, S., A. Tassa, X. Qu, R. Garuti, X. H. Liang, N. Mizushima, M. Packer, M. D.

Schneider and B. Levine (2005). "Bcl-2 antiapoptotic proteins inhibit Beclin 1-dependent

autophagy." Cell 122(6): 927-39.

Peng, C.-F., P. Lee, A. Deguzman, W. Miao, M. Chandra, J. Shirani, S. Factor, D. Lefer, G.

Condorelli, A. Ardati, K. Della Penna, S. Zinkel, S. J. Korsmeyer, G. Tremp, A.

Zilberstein and R. N. Kitsis (2001). "Multiple independent mutations in apoptotic

REFERENCES

IX

148

signaling pathways markedly decrease infarct size due to myocardial ischemia-

reperfusion." Circulation (Supp)(104): II-187.

Petiot, A., E. Ogier-Denis, E. F. Blommaart, A. J. Meijer and P. Codogno (2000). "Distinct

classes of phosphatidylinositol 3'-kinases are involved in signaling pathways that control

macroautophagy in HT-29 cells." J Biol Chem 275(2): 992-8.

Poulter, N. (2003). "Global risk of cardiovascular disease." Heart 89 Suppl 2: ii2-5; discussion

ii35-7.

Precht, T. A., R. A. Phelps, D. A. Linseman, B. D. Butts, S. S. Le, T. A. Laessig, R. J. Bouchard

and K. A. Heidenreich (2005). "The permeability transition pore triggers Bax

translocation to mitochondria during neuronal apoptosis." Cell Death Differ 12(3): 255-

65.

Presley, A. D., K. M. Fuller and E. A. Arriaga (2003). "MitoTracker Green labeling of

mitochondrial proteins and their subsequent analysis by capillary electrophoresis with

laser-induced fluorescence detection." J Chromatogr B Analyt Technol Biomed Life Sci

793(1): 141-50.

Priault, M., B. Salin, J. Schaeffer, F. M. Vallette, J. P. di Rago and J. C. Martinou (2005).

"Impairing the bioenergetic status and the biogenesis of mitochondria triggers mitophagy

in yeast." Cell Death Differ.

Pyo, J. O., M. H. Jang, Y. K. Kwon, H. J. Lee, J. I. Jun, H. N. Woo, D. H. Cho, B. Choi, H. Lee,

J. H. Kim, N. Mizushima, Y. Oshumi and Y. K. Jung (2005). "Essential roles of Atg5 and

FADD in autophagic cell death: dissection of autophagic cell death into vacuole

formation and cell death." J Biol Chem 280(21): 20722-9.

Qin, Y., T. L. Vanden Hoek, K. Wojcik, T. Anderson, C. Q. Li, Z. H. Shao, L. B. Becker and K.

J. Hamann (2004). "Caspase-dependent cytochrome c release and cell death in chick

cardiomyocytes after simulated ischemia-reperfusion." Am J Physiol Heart Circ Physiol

286(6): H2280-6.

Ravikumar, B., Z. Berger, C. Vacher, J. O'Kane C and D. C. Rubinsztein (2006). "Rapamycin

pre-treatment protects against apoptosis." Hum Mol Genet 15(7): 1209-16.

Ravikumar, B., C. Vacher, Z. Berger, J. E. Davies, S. Luo, L. G. Oroz, F. Scaravilli, D. F. Easton,

R. Duden, C. J. O'Kane and D. C. Rubinsztein (2004). "Inhibition of mTOR induces

autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of

Huntington disease." Nat Genet 36(6): 585-95.

Reed, J. C., J. M. Jurgensmeier and S. Matsuyama (1998). "Bcl-2 family proteins and

mitochondria." Biochim Biophys Acta 1366(1-2): 127-37.

Regula, K. M., K. Ens and L. A. Kirshenbaum (2002). "Inducible expression of BNIP3 provokes

mitochondrial defects and hypoxia-mediated cell death of ventricular myocytes." Circ

Res 91(3): 226-31.

Rizo, J. and T. C. Sudhof (1998). "C2-domains, structure and function of a universal Ca2+-

binding domain." J Biol Chem 273(26): 15879-82.

Rizzo, M. A., G. H. Springer, B. Granada and D. W. Piston (2004). "An improved cyan

fluorescent protein variant useful for FRET." Nat Biotechnol 22(4): 445-9.

Rizzuto, R., P. Bernardi and T. Pozzan (2000). "Mitochondria as all-round players of the calcium

game." J Physiol 529 Pt 1: 37-47.

Rizzuto, R., M. Brini, P. Pizzo, M. Murgia and T. Pozzan (1995). "Chimeric green fluorescent

protein as a tool for visualizing subcellular organelles in living cells." Curr Biol 5(6):

635-42.

Rodriguez, J. and Y. Lazebnik (1999). "Caspase-9 and APAF-1 form an active holoenzyme."

Genes Dev 13(24): 3179-84.

Row, P. E., B. J. Reaves, J. Domin, J. P. Luzio and H. W. Davidson (2001). "Overexpression of a

rat kinase-deficient phosphoinositide 3-kinase, Vps34p, inhibits cathepsin D maturation."

Biochem J 353(Pt 3): 655-61.

REFERENCES

IX

149

Saeki, K., A. Yuo, E. Okuma, Y. Yazaki, S. A. Susin, G. Kroemer and F. Takaku (2000). "Bcl-2

down-regulation causes autophagy in a caspase-independent manner in human leukemic

HL60 cells." Cell Death Differ 7(12): 1263-9.

Saftig, P., Y. Tanaka, R. Lullmann-Rauch and K. von Figura (2001). "Disease model: LAMP-2

enlightens Danon disease." Trends Mol Med 7(1): 37-9.

Saijo, M., G. Takemura, M. Koda, H. Okada, S. Miyata, Y. Ohno, M. Kawasaki, K. Tsuchiya, K.

Nishigaki, S. Minatoguchi, K. Goto and H. Fujiwara (2004). "Cardiomyopathy with

prominent autophagic degeneration, accompanied by an elevated plasma brain natriuretic

peptide level despite the lack of overt heart failure." Intern Med 43(8): 700-3.

Saito, M., S. J. Korsmeyer and P. H. Schlesinger (2000). "BAX-dependent transport of

cytochrome c reconstituted in pure liposomes." Nat Cell Biol 2(8): 553-5.

Santel, A. and M. T. Fuller (2001). "Control of mitochondrial morphology by a human

mitofusin." J Cell Sci 114(Pt 5): 867-74.

Saraste, A. (1999a). "Morphologic criteria and detection of apoptosis." Herz 24(3): 189-95.

Saraste, M. (1999b). "Oxidative phosphorylation at the fin de siecle." Science 283(5407): 1488-

93.

Scarabelli, T. M., A. Stephanou, E. Pasini, L. Comini, R. Raddino, R. A. Knight and D. S.

Latchman (2002). "Different signaling pathways induce apoptosis in endothelial cells and

cardiac myocytes during ischemia/reperfusion injury." Circ Res 90(6): 745-8.

Scharf, S. J., G. T. Horn and H. A. Erlich (1986). "Direct cloning and sequence analysis of

enzymatically amplified genomic sequences." Science 233(4768): 1076-8.

Schmelzle, T. and M. N. Hall (2000). "TOR, a central controller of cell growth." Cell 103(2):

253-62.

Schmitz, I., S. Kirchhoff and P. H. Krammer (2000). "Regulation of death receptor-mediated

apoptosis pathways." Int J Biochem Cell Biol 32(11-12): 1123-36.

Schoppet, M., V. Ruppert, L. C. Hofbauer, S. Henser, N. Al-Fakhri, M. Christ, S. Pankuweit and

B. Maisch (2005). "TNF-related apoptosis-inducing ligand and its decoy receptor

osteoprotegerin in nonischemic dilated cardiomyopathy." Biochem Biophys Res

Commun 338(4): 1745-50.

Schu, P. V., K. Takegawa, M. J. Fry, J. H. Stack, M. D. Waterfield and S. D. Emr (1993).

"Phosphatidylinositol 3-kinase encoded by yeast VPS34 gene essential for protein

sorting." Science 260(5104): 88-91.

Schumann, H., H. Morawietz, K. Hakim, H. R. Zerkowski, T. Eschenhagen, J. Holtz and D.

Darmer (1997). "Alternative splicing of the primary Fas transcript generating soluble Fas

antagonists is suppressed in the failing human ventricular myocardium." Biochem

Biophys Res Commun 239(3): 794-8.

Scorrano, L., M. Ashiya, K. Buttle, S. Weiler, S. A. Oakes, C. A. Mannella and S. J. Korsmeyer

(2002). "A distinct pathway remodels mitochondrial cristae and mobilizes cytochrome c

during apoptosis." Dev Cell 2(1): 55-67.

Searle, J., J. F. Kerr and C. J. Bishop (1982). "Necrosis and apoptosis: distinct modes of cell

death with fundamentally different significance." Pathol Annu 17 Pt 2: 229-59.

Seglen, P. O. and P. Bohley (1992). "Autophagy and other vacuolar protein degradation

mechanisms." Experientia 48(2): 158-72.

Seglen, P. O. and P. B. Gordon (1982). "3-Methyladenine: specific inhibitor of

autophagic/lysosomal protein degradation in isolated rat hepatocytes." Proc Natl Acad

Sci U S A 79(6): 1889-92.

Severs, N. J. (2000). "The cardiac muscle cell." Bioessays 22(2): 188-99.

Shaner, N. C., R. E. Campbell, P. A. Steinbach, B. N. Giepmans, A. E. Palmer and R. Y. Tsien

(2004). "Improved monomeric red, orange and yellow fluorescent proteins derived from

Discosoma sp. red fluorescent protein." Nat Biotechnol 22(12): 1567-72.

REFERENCES

IX

150

Sharpe, J. C., D. Arnoult and R. J. Youle (2004). "Control of mitochondrial permeability by Bcl-2

family members." Biochim Biophys Acta 1644(2-3): 107-13.

Shi, Y. (2002). "Mechanisms of caspase activation and inhibition during apoptosis." Mol Cell

9(3): 459-70.

Shibata, M., T. Lu, T. Furuya, A. Degterev, N. Mizushima, T. Yoshimori, M. Macdonald, B.

Yankner and J. Yuan (2006). "Regulation of intracellular accumulation of mutant

Huntingtin by Beclin 1." J Biol Chem.

Shimizu, S., T. Kanaseki, N. Mizushima, T. Mizuta, S. Arakawa-Kobayashi, C. B. Thompson and

Y. Tsujimoto (2004). "Role of Bcl-2 family proteins in a non-apoptotic programmed cell

death dependent on autophagy genes." Nat Cell Biol 6(12): 1221-8.

Shimizu, S., M. Narita and Y. Tsujimoto (1999). "Bcl-2 family proteins regulate the release of

apoptogenic cytochrome c by the mitochondrial channel VDAC." Nature 399(6735): 483-

7.

Shimomura, H., F. Terasaki, T. Hayashi, Y. Kitaura, T. Isomura and H. Suma (2001).

"Autophagic degeneration as a possible mechanism of myocardial cell death in dilated

cardiomyopathy." Jpn Circ J 65(11): 965-8.

Shintani, T. and D. J. Klionsky (2004). "Autophagy in Health and Disease: A Double-Edged

Sword." Science 306(5698): 990-995.

Skulachev, V. P. (2000). "Mitochondria in the programmed death phenomena; a principle of

biology: "it is better to die than to be wrong"." IUBMB Life 49(5): 365-73.

Skulachev, V. P., L. E. Bakeeva, B. V. Chernyak, L. V. Domnina, A. A. Minin, O. Y.

Pletjushkina, V. B. Saprunova, I. V. Skulachev, V. G. Tsyplenkova, J. M. Vasiliev, L. S.

Yaguzhinsky and D. B. Zorov (2004). "Thread-grain transition of mitochondrial

reticulum as a step of mitoptosis and apoptosis." Mol Cell Biochem 256-257(1-2): 341-

58.

Smirnova, E., L. Griparic, D. L. Shurland and A. M. van der Bliek (2001). "Dynamin-related

protein Drp1 is required for mitochondrial division in mammalian cells." Mol Biol Cell

12(8): 2245-56.

Smirnova, E., D. L. Shurland, S. N. Ryazantsev and A. M. van der Bliek (1998). "A human

dynamin-related protein controls the distribution of mitochondria." J Cell Biol 143(2):

351-8.

Soltoff, S. P. (2004). "Evidence that tyrphostins AG10 and AG18 are mitochondrial uncouplers

that alter phosphorylation-dependent cell signaling." J Biol Chem 279(12): 10910-8.

Stein, M. P., Y. Feng, K. L. Cooper, A. M. Welford and A. Wandinger-Ness (2003). "Human

VPS34 and p150 are Rab7 interacting partners." Traffic 4(11): 754-71.

Stennicke, H. R. and G. S. Salvesen (2000). "Caspases - controlling intracellular signals by

protease zymogen activation." Biochim Biophys Acta 1477(1-2): 299-306.

Stoka, V., B. Turk, S. L. Schendel, T. H. Kim, T. Cirman, S. J. Snipas, L. M. Ellerby, D.

Bredesen, H. Freeze, M. Abrahamson, D. Bromme, S. Krajewski, J. C. Reed, X. M. Yin,

V. Turk and G. S. Salvesen (2001). "Lysosomal protease pathways to apoptosis.

Cleavage of bid, not pro-caspases, is the most likely route." J Biol Chem 276(5): 3149-

57.

Stypmann, J., P. M. Janssen, J. Prestle, M. A. Engelen, H. Kogler, R. Lullmann-Rauch, L.

Eckardt, K. von Figura, J. Landgrebe, A. Mleczko and P. Saftig (2006). "LAMP-2

deficient mice show depressed cardiac contractile function without significant changes in

calcium handling." Basic Res Cardiol.

Sun-Wada, G. H., Y. Wada and M. Futai (2003). "Lysosome and lysosome-related organelles

responsible for specialized functions in higher organisms, with special emphasis on

vacuolar-type proton ATPase." Cell Struct Funct 28(5): 455-63.

REFERENCES

IX

151

Susin, S. A., N. Zamzami, M. Castedo, T. Hirsch, P. Marchetti, A. Macho, E. Daugas, M.

Geuskens and G. Kroemer (1996). "Bcl-2 inhibits the mitochondrial release of an

apoptogenic protease." J Exp Med 184(4): 1331-41.

Sutton, V. R., J. E. Davis, M. Cancilla, R. W. Johnstone, A. A. Ruefli, K. Sedelies, K. A. Browne

and J. A. Trapani (2000). "Initiation of apoptosis by granzyme B requires direct cleavage

of bid, but not direct granzyme B-mediated caspase activation." J Exp Med 192(10):

1403-14.

Szabadkai, G., A. M. Simoni, M. Chami, M. R. Wieckowski, R. J. Youle and R. Rizzuto (2004).

"Drp-1-dependent division of the mitochondrial network blocks intraorganellar Ca2+

waves and protects against Ca2+-mediated apoptosis." Mol Cell 16(1): 59-68.

Tanida, I., N. Minematsu-Ikeguchi, T. Ueno and E. Kominami (2005). "Lysosomal Turnover, but

Not a Cellular Level, of Endogenous LC3 is a Marker for Autophagy." Autophagy 1(2):

084-091.

Tanida, I., T. Ueno and E. Kominami (2004). "LC3 conjugation system in mammalian

autophagy." Int J Biochem Cell Biol 36(12): 2503-18.

Tartaglia, L. A. and D. V. Goeddel (1992). "Two TNF receptors." Immunol Today 13(5): 151-3.

Terman, A., H. Dalen, J. W. Eaton, J. Neuzil and U. T. Brunk (2003). "Mitochondrial recycling

and aging of cardiac myocytes: the role of autophagocytosis." Exp Gerontol 38(8): 863-

76.

Tewari, M., L. T. Quan, K. O'Rourke, S. Desnoyers, Z. Zeng, D. R. Beidler, G. G. Poirier, G. S.

Salvesen and V. M. Dixit (1995). "Yama/CPP32 beta, a mammalian homolog of CED-3,

is a CrmA-inhibitable protease that cleaves the death substrate poly(ADP-ribose)

polymerase." Cell 81(5): 801-9.

Thastrup, O., P. J. Cullen, B. K. Drobak, M. R. Hanley and A. P. Dawson (1990). "Thapsigargin,

a tumor promoter, discharges intracellular Ca2+ stores by specific inhibition of the

endoplasmic reticulum Ca2(+)-ATPase." Proc Natl Acad Sci U S A 87(7): 2466-70.

Thom, T., N. Haase, W. Rosamond, V. J. Howard, J. Rumsfeld, T. Manolio, Z. J. Zheng, K.

Flegal, C. O'Donnell, S. Kittner, D. Lloyd-Jones, D. C. Goff, Jr., Y. Hong, R. Adams, G.

Friday, K. Furie, P. Gorelick, B. Kissela, J. Marler, J. Meigs, V. Roger, S. Sidney, P.

Sorlie, J. Steinberger, S. Wasserthiel-Smoller, M. Wilson and P. Wolf (2006). "Heart

disease and stroke statistics--2006 update: a report from the American Heart Association

Statistics Committee and Stroke Statistics Subcommittee." Circulation 113(6): e85-151.

Thornberry, N. A. and Y. Lazebnik (1998). "Caspases: enemies within." Science 281(5381):

1312-6.

Tokunaga, C., K. Yoshino and K. Yonezawa (2004). "mTOR integrates amino acid- and energy-

sensing pathways." Biochem Biophys Res Commun 313(2): 443-6.

Trost, S. U., J. H. Omens, W. J. Karlon, M. Meyer, R. Mestril, J. W. Covell and W. H. Dillmann

(1998). "Protection Against Myocardial Dysfunction After a Brief Ischemic Period in

Transgenic Mice Expressing Inducible Heat Shock Protein 70 " J. Clin. Invest. 101(4):

855-862.

Tsang, A., D. J. Hausenloy, M. M. Mocanu and D. M. Yellon (2004). "Postconditioning: a form

of "modified reperfusion" protects the myocardium by activating the phosphatidylinositol

3-kinase-Akt pathway." Circ Res 95(3): 230-2.

Tsien, R. Y. (1980). "New calcium indicators and buffers with high selectivity against

magnesium and protons: design, synthesis, and properties of prototype structures."

Biochemistry 19(11): 2396-404.

Turrens, J. F., A. Alexandre and A. L. Lehninger (1985). "Ubisemiquinone is the electron donor

for superoxide formation by complex III of heart mitochondria." Arch Biochem Biophys

237(2): 408-14.

Turrens, J. F. and A. Boveris (1980). "Generation of superoxide anion by the NADH

dehydrogenase of bovine heart mitochondria." Biochem J 191(2): 421-7.

REFERENCES

IX

152

Uchiyama, Y. (2001). "Autophagic cell death and its execution by lysosomal cathepsins." Arch

Histol Cytol 64(3): 233-46.

Vande Velde, C., J. Cizeau, D. Dubik, J. Alimonti, T. Brown, S. Israels, R. Hakem and A. H.

Greenberg (2000). "BNIP3 and genetic control of necrosis-like cell death through the

mitochondrial permeability transition pore." Mol Cell Biol 20(15): 5454-68.

Vanden Hoek, T. L., L. B. Becker, Z. Shao, C. Li and P. T. Schumacker (1998). "Reactive

oxygen species released from mitochondria during brief hypoxia induce preconditioning

in cardiomyocytes." J Biol Chem 273(29): 18092-8.

Vanden Hoek, T. L., Z. Shao, C. Li, P. T. Schumacker and L. B. Becker (1997). "Mitochondrial

electron transport can become a significant source of oxidative injury in

cardiomyocytes." J Mol Cell Cardiol 29(9): 2441-50.

Verhagen, A. M., P. G. Ekert, M. Pakusch, J. Silke, L. M. Connolly, G. E. Reid, R. L. Moritz, R.

J. Simpson and D. L. Vaux (2000). "Identification of DIABLO, a mammalian protein that

promotes apoptosis by binding to and antagonizing IAP proteins." Cell 102(1): 43-53.

Vieira, O. V., R. J. Botelho, L. Rameh, S. M. Brachmann, T. Matsuo, H. W. Davidson, A.

Schreiber, J. M. Backer, L. C. Cantley and S. Grinstein (2001). "Distinct roles of class I

and class III phosphatidylinositol 3-kinases in phagosome formation and maturation." J

Cell Biol 155(1): 19-25.

Wang, K., X. M. Yin, D. T. Chao, C. L. Milliman and S. J. Korsmeyer (1996). "BID: a novel

BH3 domain-only death agonist." Genes Dev 10(22): 2859-69.

Waters, M. G. and S. R. Pfeffer (1999). "Membrane tethering in intracellular transport." Curr

Opin Cell Biol 11(4): 453-9.

Webb, J. L., B. Ravikumar, J. Atkins, J. N. Skepper and D. C. Rubinsztein (2003). "Alpha-

Synuclein is degraded by both autophagy and the proteasome." J Biol Chem 278(27):

25009-13.

Webb, J. L., B. Ravikumar and D. C. Rubinsztein (2004). "Microtubule disruption inhibits

autophagosome-lysosome fusion: implications for studying the roles of aggresomes in

polyglutamine diseases." Int J Biochem Cell Biol 36(12): 2541-50.

Wei, M. C., T. Lindsten, V. K. Mootha, S. Weiler, A. Gross, M. Ashiya, C. B. Thompson and S.

J. Korsmeyer (2000). "tBID, a membrane-targeted death ligand, oligomerizes BAK to

release cytochrome c." Genes Dev 14(16): 2060-71.

Weiner, M. P., T. Gackstetter, G. L. Costa, J. C. Bauer and K. A. Kretz (1995). Site-directed

Mutagenesis using PCR. Wymondham, Horizon Scientific Press.

Weiss, J. N., P. Korge, H. M. Honda and P. Ping (2003). "Role of the Mitochondrial Permeability

Transition in Myocardial Disease." Circ Res 93(4): 292-301.

Werneburg, N., M. E. Guicciardi, X. M. Yin and G. J. Gores (2004). "TNF-alpha-mediated

lysosomal permeabilization is FAN and caspase 8/Bid dependent." Am J Physiol

Gastrointest Liver Physiol 287(2): G436-43.

White, S. M., P. E. Constantin and W. C. Claycomb (2004). "Cardiac physiology at the cellular

level: use of cultured HL-1 cardiomyocytes for studies of cardiac muscle cell structure

and function." Am J Physiol Heart Circ Physiol 286(3): H823-829.

Winchester, B. G. (2001). "Lysosomal membrane proteins." Eur J Paediatr Neurol 5 Suppl A: 11-

9.

Wolter, K. G., Y. T. Hsu, C. L. Smith, A. Nechushtan, X. G. Xi and R. J. Youle (1997).

"Movement of Bax from the cytosol to mitochondria during apoptosis." J Cell Biol

139(5): 1281-92.

Xu, C., B. Bailly-Maitre and J. C. Reed (2005). "Endoplasmic reticulum stress: cell life and death

decisions." J Clin Invest 115(10): 2656-64.

Xue, L., G. C. Fletcher and A. M. Tolkovsky (1999). "Autophagy is activated by apoptotic

signalling in sympathetic neurons: an alternative mechanism of death execution." Mol

Cell Neurosci 14(3): 180-98.

REFERENCES

IX

153

Xue, L., G. C. Fletcher and A. M. Tolkovsky (2001). "Mitochondria are selectively eliminated

from eukaryotic cells after blockade of caspases during apoptosis." Curr Biol 11(5): 361-

5.

Yamaguchi, S., M. Yamaoka, M. Okuyama, J. Nitoube, A. Fukui, M. Shirakabe, K. Shirakawa,

N. Nakamura and H. Tomoike (1999). "Elevated circulating levels and cardiac secretion

of soluble Fas ligand in patients with congestive heart failure." Am J Cardiol 83(10):

1500-3, A8.

Yamamoto, A., Y. Tagawa, T. Yoshimori, Y. Moriyama, R. Masaki and Y. Tashiro (1998).

"Bafilomycin A1 prevents maturation of autophagic vacuoles by inhibiting fusion

between autophagosomes and lysosomes in rat hepatoma cell line, H-4-II-E cells." Cell

Struct Funct 23(1): 33-42.

Yan, L., D. E. Vatner, S. J. Kim, H. Ge, M. Masurekar, W. H. Massover, G. Yang, Y. Matsui, J.

Sadoshima and S. F. Vatner (2005). "Autophagy in chronically ischemic myocardium."

Proc Natl Acad Sci U S A 102(39): 13807-12.

Yanagisawa, H., T. Miyashita, Y. Nakano and D. Yamamoto (2003). "HSpin1, a transmembrane

protein interacting with Bcl-2/Bcl-xL, induces a caspase-independent autophagic cell

death." Cell Death Differ 10(7): 798-807.

Yasuda, M., P. Theodorakis, T. Subramanian and G. Chinnadurai (1998). "Adenovirus E1B-

19K/BCL-2 interacting protein BNIP3 contains a BH3 domain and a mitochondrial

targeting sequence." J Biol Chem 273(20): 12415-21.

Yi, X., X. M. Yin and Z. Dong (2003). "Inhibition of Bid-induced apoptosis by Bcl-2. tBid

insertion, Bax translocation, and Bax/Bak oligomerization suppressed." J Biol Chem

278(19): 16992-9.

Yoshimori, T., A. Yamamoto, Y. Moriyama, M. Futai and Y. Tashiro (1991). "Bafilomycin A1, a

specific inhibitor of vacuolar-type H(+)-ATPase, inhibits acidification and protein

degradation in lysosomes of cultured cells." J Biol Chem 266(26): 17707-12.

Yu, L., A. Alva, H. Su, P. Dutt, E. Freundt, S. Welsh, E. H. Baehrecke and M. J. Lenardo (2004).

"Regulation of an ATG7-beclin 1 program of autophagic cell death by caspase-8."

Science 304(5676): 1500-2.

Yuan, H., S. D. Williams, S. Adachi, T. Oltersdorf and R. A. Gottlieb (2003). "Cytochrome c

dissociation and release from mitochondria by truncated Bid and ceramide."

Mitochondrion 2(4): 237-44.

Yue, Z., S. Jin, C. Yang, A. J. Levine and N. Heintz (2003). "Beclin 1, an autophagy gene

essential for early embryonic development, is a haploinsufficient tumor suppressor."

PNAS 100(25): 15077-15082.

Zeng, X., J. H. Overmeyer and W. A. Maltese (2006). "Functional specificity of the mammalian

Beclin-Vps34 PI 3-kinase complex in macroautophagy versus endocytosis and lysosomal

enzyme trafficking." J Cell Sci 119(Pt 2): 259-70.

Zerial, M. and H. McBride (2001). "Rab proteins as membrane organizers." Nat Rev Mol Cell

Biol 2(2): 107-17.

Zha, J., S. Weiler, K. J. Oh, M. C. Wei and S. J. Korsmeyer (2000). "Posttranslational N-

myristoylation of BID as a molecular switch for targeting mitochondria and apoptosis."

Science 290(5497): 1761-5.

Zhu, H. L., A. S. Stewart, M. D. Taylor, C. Vijayasarathy, T. J. Gardner and H. L. Sweeney

(2000). "Blocking free radical production via adenoviral gene transfer decreases cardiac

ischemia-reperfusion injury." Mol Ther 2(5): 470-5.

Zorov, D. B., C. R. Filburn, L. O. Klotz, J. L. Zweier and S. J. Sollott (2000). "Reactive oxygen

species (ROS)-induced ROS release: a new phenomenon accompanying induction of the

mitochondrial permeability transition in cardiac myocytes." J Exp Med 192(7): 1001-14.

Zweier, J. L., J. T. Flaherty and M. L. Weisfeldt (1987). Proc Natl Acad Sci U S A 84(5): 1404-7.

APPENDIX

X

155

X Appendix

X-1 Figure index

FIG. 1. Comprehensive schema of signaling pathways implicated in apoptosis (PCD type

I) of cardiac myocytes. 9

FIG. 2. Bcl-2 homology domains. 13

FIG. 3. Macroautophagy is a three-step process. 16

FIG. 4. Two ubiquitin-like conjugation systems during autophagosome formation. 18

FIG. 5. Molecular mechanism and regulation of autophagy. 21

FIG. 6. sI/R in HL-1 cardiac myocytes leads to mitochondrial dysfunction. 46

FIG. 7. sI/R causes the disruption of the mitochondrial network. 47

FIG. 8. Drp1 mediates the disruption of the mitochondrial network. 49

FIG. 9. sI/R-induced Bax translocation to mitochondria. 50

FIG. 10. Bax translocation to mitochondria independent of mitochondrial dysfunction.52

FIG. 11. MPTP is upstream of GFP-Bax activation. 53

FIG. 12. sI/R-specific GFP-Bax clustering. 54

FIG. 13. Anti-apoptotic Bcl-2 and Bcl-xL oppose sI/R-induced GFP-Bax clustering. 55

FIG. 14. Fissioned mitochondria afford protection from sI/R injury in HL-1 cells and Bcl-

xL protects independently of mitochondrial fission. 56

FIG. 15. YFP-Bid-CFP sensor to monitor Bid activation. 58

FIG. 16. Bid cleavage during sI/R is mediated by caspase 8. 59

FIG. 17. Sequential activation of Bax and Bid in response to sI/R. 60

FIG. 18. Inhibition of lysosomal activity with the inhibitor cocktail. 66

FIG. 19. Basal and rapamycin-activated autophagic activity in full medium. 68

FIG. 20. Autophagic flux under nutrient deprivation. 69

FIG. 21. Atg5 control of autophagosome formation. 71

FIG. 22. Beclin1 regulation of the autophagic response. 74

FIG. 23. Bcl-2 control of autophagic activity. 75

FIG. 24. Bcl-2 reduces S/ER Ca2+

content. 76

FIG. 25. Role of S/ER Ca2+

stores on nutrient deprivation induced autophagy. 77

FIG. 26. Analysis of cellular autophagosomal content during sI/R. 82

FIG. 27. Flux of LC3-II degradation during sI/R. 84

FIG. 28. Assessment of lysosomal activity and participation in pro-death signaling. 85

FIG. 29. Pharmacologic interference with autophagy induction. 88

FIG. 30. Effect of pharmacological interference upstream of AV formation on sI/R

injury. 89

FIG. 31. Beclin 1 overexpression protects against sI/R injury. 90

FIG. 32. Beclin1-mediated protection in sI/R correlates with its effect on autophagy. 93

FIG. 33. Inhibition of Atg5 increases sI/R injury and abolishes protection through

Beclin1 95

APPENDIX

X

156

FIG. 34. sI/R leads to autophagic sequestration of fragmented mitochondria. 101

FIG. 35. Bnip3 mediates sI/R injury in the HL-1 cardiac myocyte. 103

FIG. 36. Bnip3 overexpression activates cell death in HL-1 cardiac myocytes. 103

FIG. 37. Bnip3 overexpression increases autophagic flux in full medium. 105

FIG. 38. Fusion between AVs and lysosomes seems functional in Bnip3-overexpressing

cells. 106

FIG. 39. Bnip3 overexpression results in fragmentation of the mitochondrial network.106

FIG. 40. Bnip3 overexpression activates mitophagy. 108

FIG. 41. Modulation of autophagy affects Bnip3-mediated cell death. 109

FIG. 42. Time-line of events during sI/R in HL-1 cells 119

FIG. 43. Autophagy in HL-1 cardiac myocytes 127

X-2 Oligonucleotides

Construct Oligo Comment Sequence1

pmCherry-

C1

Forw. AgeI GTAACCGGTATGGTGAGCAAGGGCGAG

Rev. BglII GTAAGATCTCTTG TACAGCTCGTCCATGC

mCherry-

Bax(WT)

Forw. BglII GTAAGATCTATGGACGGGTCCGGGGAG

Rev. EcoRI GTAGAATTCTCAGCCCACT TCTTCCAGATGGTG

mCherry-

BaxT182A

Forw. T182A GGGAGTGCTCGCCGCCTCACTCACCATCTGG

Rev. CCAGATGGTGAGTGAGGCGGCGAGCACTCCC

YFP-Bid-

CFP

Forw. YFP(AgeI) GTAACCGGTATGGTGAGCAAGGGCGAGG

Rev. YFP(XhoI) GTACTCGAGCTTGTACAGCTCGTCCATGC

Forw. Bid(XhoI) GTACTCGAGATGGACTGTGAGGTCAACAACG

Rev. Bid(SphI) GTAGCATGCGTCCATCCCATTTCTGGC

Forw. CFP(SphI) GTAGCATGCATGGTGAGCAAGGGCGAGG

Rev. CFP(NotI) GCAGCGGCCGCTTACTTGTACAGCTCGTCC

Bid∆casp8 Forw. D60E GAGCTGCAGACTGAGGGCAACCGCAGCAGC

Rev. GCTGCTGCGGTTGCCCTCAGTCTGCAGCTC

Atg5 Forw. XhoI GTACTCGAGGGATGACAGATGACAAAGATGTG

Rev. BamHI GTAGGATCCATCTGTTGGCTGGGGGAC

Atg5K130R

Forw. K130R GTCGTGTATGAGAGAAGCTGATG

Rev. CATCAGCTTCTCTCATACACGAC

Bnip3

miRNA

‘78’ Target TCCAGCCTCCGTCTCTATTTA

Complement TAAATAGAGACGGAGGCTGGA

Beclin1 ‘a’ Target TGAAACTTCAGACCCATCTTA

miRNA Complement TAAGATGGGTCTGAAGTTTCA

‘b’ Target TAATGGAGCTGTGAGTTCCTG

Complement CAGGAACTCACAGCTCCATTA 1Sequences are shown 5-prime to 3-prime with restriction sites underlined. Oligo,

oligonucleotide; Forw., forward; Rev., reverse

APPENDIX

X

157

X-3 Amino acid code

Single letter code Abbreviation Amino acid

G Gly Glycine

P Pro Proline

A Ala Alanine

V Val Valine

L Leu Leucine

I Ile Isoleucine

M Met Methionine

C Cys Cysteine

F Phe Phenylalanine

Y Tyr Tyrosine

W Trp Tryptophan

H His Histidine

K Lys Lysine

R Arg Arginine

Q Gln Glutamine

N Asn Asparagine

E Glu Glutamic acid

D Asp Aspartic acid

S Ser Serine

T Thr Threonine

APPENDIX

X

158

X-4 Fluorescent dyes

Fluorescent dye2

Abbreviation Excitation/Emission

Maxima (nm)

Concentration Phenomenon/

specificity

Carboxymethyl-

dihydrochlorofluorescein

diacetate

CM-H2DCF-

DA 500 /530 10 µM ROS

Fluo-4 Fluo-4 491 /518 2 µM Ca2+

LysoTracker Red

LTR 577 /590 50 nM Acidic vesicles

(z-RR)2-MagicRed-

Cathepsin B substrate MagicRed 550 /610 10 nM Cathepsin B

Rhodamine 123 Rhod123 485 /530 50 nM ∆Ψm

Tetramethylrhodamine

methyl ester TMRM 556 /576 100 nM ∆Ψm

Yo-Pro-1 iodide YoPro1 491 /509 100 nM Plasmamembrane

integrity 2Listed are the fluorescent dyes used in this thesis.

X-5 Fluorescent protein variants

Fluorescent protein

variant3

Abbreviation Excitation/

Emission

Maxima (nm)

Comments Originator

Green fluorescent protein GFP 488 /509 variant ‘EGFP’ Clontech

Cyan fluorescent protein CFP 433 (452) /475

(505) variant ‘ECFP’ Clontech

ECFPS72A/Y145A/H148D

Cerulean 433 /475 brighter, >lifetime Dr. D. Piston

DsRed2 DsRed2 558 /583 forms dimers Clontech

mCherry mCherry 587 /610 monomeric Dr. R. Tsien

Yellow fluorescent protein YFP 516/ 529 variant ‘EYFP’ Clontech

EYFP F64L/M153T/V163A/S175G

Venus 515 /528 pH & Cl- insensitive Dr. A. Miyawaki

3Listed are the fluorescent protein variants used in this thesis. ‘E’ in ‘EGFP’, ‘ECFP’, and ‘EYFP’:

enhanced.

APPENDIX

X

159

X-6 Vector maps

X-6.1 pECFP-mito

X-6.2 p_mCherry-C1

APPENDIX

X

160

X-6.3 p_mCherry-Bax

X-6.4 mCherry-Atg5

APPENDIX

X

161

X-6.5 YFP-Bid-CFP

ACKNOWLEDGEMENTS

.

Acknowledgements

I sincerely thank Prof. Dr. Fritz Kreuzaler for serving as my promoter at the RWTH

Aachen, and Dr. habil. Christoph Peterhänsel and Prof. Dr. Margit Frentzen for serving as

members of my thesis committee.

I would like to thank my mentor Dr. Robbie Gottlieb at The Scripps Research Institute

for the opportunity to perform my doctoral studies in her lab. Her guidance and

enthusiasm are reflected throughout this thesis and will continue to inspire me well into

the next stages of my career.

I am grateful to all members of the Gottlieb lab for the nice time spent together; in

particular, Rick Sayen for his technical support, Dr. Asa Gustafsson for the fruitful

collaboration, and Dr. Chengqun Huang for interesting discussions.

Special thanks go to my husband Nathan Brady for the continuous collaboration, his

excitement about our work, and his emotional support.

Much of this work was made possible by the generosity of others: HL-1 cells were kindly

provided by Dr. William Claycomb (LSU Health Sciences Center, Louisiana). I would

like to thank Dr. Richard Youle (National Institutes of Health, Maryland) for pEGFP-

Bax, Dr. Roger Tsien (University of California, San Diego) for pRSET-mCherry, Dr.

Lorie Kirshenbaum for the Bnip3 and Bnip3∆TM constructs, Dr. Atsushi Miyawaki

(Brain Science Institute, RIKEN, Japan) for Venus YFP variant, Dr. David Piston

(Vanderbilt University Medical Center, Tennessee) for Cerulean CFP variant, Dr. Beth

Levine (University of Texas Southwestern, Texas) for flag-Beclin1 and flag-

Beclin1∆Bcl2BD, Dr. Ella Bossy-Wetzel (Burnham Institute, California) for Bcl-xL, Dr.

Harald Stenmark (Norwegian Radium Hospital, Norway) for pEGFP-2xFYVE, Dr.

Tamotsu Yoshimori (National Institute of Genetics, Japan) for GFP-LC3, and Dr. Clark

Distelhorst (Case Western Reserve University, Ohio) for flag-Bcl-2.

Bildungsgang der Verfasserin

1984 – 1988 Gemeinschaftsgundschule Haaren in Aachen

1988 – 1997 Einhard-Gymnasium in Aachen

Abschluß: Allgemeine Hochschulreife

Rheinisch Westfälische Technische Hochschule (RWTH) Aachen, Germany

1997 – 1999 Studium der Anglistik, Biologie und Erziehungswissenschaften

(Lehramt)

1999 – 2003 Studium der Biologie (Diplom)

2002 Forschungspraktikum im Rahmen eines Erasmus-

Austauschprogrammes im Institut für Molekulare Zellphysiologie

der Vrijen Universiteit Amsterdam, Niederlande: “MitoTracker

Green evidences subcellular localization of dihydrolipoamide

dehydrogenase in Paracoccus denitrificans”

2003 Diplomarbeit im Institut für Molekulare Zellphysiologie der Vrijen

Universiteit Amsterdam: “Dynamics of mitochondrial organization

and communication in the adult cardiomyocyte - a study employing

laser scanning confocal microscopy”

Abschluß: Diplom-Biologin, Prädikat: mit Auszeichnung

2003 – 2006 Externe Promotion in der Abteilung für Molekulare &

Experimentelle Medizin des Scripps Research Institutes in La

Jolla, Kalifornien: “The interplay between pro-death and pro-

survival pathways converging at mitochondria in myocardial

ischemia/reperfusion: apoptosis meets autophagy”

Publications

Hamacher-Brady A., Brady N.R., Logue S.E., Sayen M.R., Jinno M., Kirshenbaum

L.A., Gottlieb R.A., and A.B. Gustafsson (2006). “Response to myocardial

ischemia/reperfusion injury involves Bnip3 and autophagy”. Cell Death Differ. 2006 Apr

28

Brady N.R.1, Hamacher-Brady A.

1, and R.A. Gottlieb (2006). “Pro-apoptotic Bcl-2

family members and mitochondrial dysfunction during ischemia/reperfusion injury, a

study employing cardiac HL-1 cells and GFP-biosensors. BBA-Bioenergetics. 2006 May-

Jun;1757(5-6):667-78. (1Authors contributed equally.)

Hamacher-Brady A., Brady N.R., and R.A. Gottlieb. “Enhancing macroautophagy

protects against ischemia/reperfusion injury in cardiac myocytes.” J Biol Chem. 2006

Aug 1

Hamacher-Brady A., Brady N.R., Gottlieb R.A., and AB Gustafsson. Autophagy as a

Protective Response to Bnip3-Mediated Apoptotic Signaling in the Heart. Autophagy.

2006 Oct 25;2(4)

Brady N.R., Hamacher-Brady A., Westerhoff H.V., and R.A. Gottlieb (2006). “A wave

of reactive oxygen species (ROS)-induced ROS release in a sea of excitable

mitochondria.” Antioxid Redox Signal. 2006 Sep-Oct;8(9-10):1651-65. Review.

Hamacher-Brady A., Brady N.R., and R.A. Gottlieb. “The interplay between pro-death

and pro-survival signaling pathways in myocardial ischemia/reperfusion: apoptosis meets

autophagy.” Cardiovasc Drugs Ther. In press. Review.

Huang C., Tsukada Y., Brady N.R., Jinno M., Paromov V., Hamacher-Brady A., and

R.A. Gottlieb. “Reperfusion Injury is Mediated by Reactive Oxygen Species,

Arachidonic Acid Metabolism, and p38 MAPK in a Sulfaphenazole-Sensitive Pathway.”

Submitted.

Brady N.R., Hamacher-Brady A., and R.A. Gottlieb. “Bcl-2 regulation of

sarco/endoplasmic reticulum calcium stores mediates the autophagic response to nutrient

deprivation in the HL-1 cardiac myocyte.” Submitted.

Abstracts

Graduate Research Schools GKB (Berlin) and BCA (Amsterdam) Cell Systems Biology

Meeting, Berlin 2002. Poster: MitoTracker Green evidences subcellular localization of

dihydrolipoamide dehydrogenase in Paracoccus denitrificans.

NOW-CW Study Group on Lipids and Biomembranes, 2003. Poster: MitoTracker Green

evidences subcellular localization of dihydrolipoamide dehydrogenase in Paracoccus

denitrificans.

American Heart Association (AHA), Annual meeting ‘Scientific Sessions 2004’, New

Orleans 2004. Oral presentation: Time-resolved mitochondrial events during simulated

ischemia/reperfusion in adult cardiomyocytes.

International Society of Heart Research (ISHR), Annual meeting, New Orleans 2005.

Poster: Investigating the role of autophagy during simulated ischemia/reperfusion in

cardiac myocytes.

‘Jahrestagung deutscher Nachwuchswissenschaftler’, San Diego 2005. Abstract:

Enhancing macroautophagy protects against ischemia/reperfusion in cardiac myocytes.

American Heart Association (AHA), Annual meeting ‘Scientific Sessions 2005’, Dallas

2005. Poster (1): Mitochondrial autophagy (mitophagy) functions as a survival response

during ischemia/reperfusion injury in cardiac myocytes. Poster (2): Bnip3 Triggers

Mitochondrial Fragmentation and Autophagy in Ischemia/ Reperfusion.